View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6086_low_21 (Length: 243)

Name: NF6086_low_21
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6086_low_21
NF6086_low_21
[»] chr1 (1 HSPs)
chr1 (64-227)||(3261312-3261474)


Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 64 - 227
Target Start/End: Original strand, 3261312 - 3261474
Alignment:
64 gatgtgttcaaattatattgtcaaaagagaaatactaggacacactatgcaatagtcattcttttattgacaacaatcggatctattttaacgtacggta 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||| |||||||||   ||||||||||||||| ||||    
3261312 gatgtgttcaaattatattgtcaaaagagaaatactaggacacactatgcaacaatcgttcttttatcgacaacaattaaatctattttaacgtaaggta 3261411  T
164 ctaacattaattttaactaatnnnnnnnntagatgttaaaaatagaatgtttttggcacttttt 227  Q
    ||||||||||| |||||||||        |||||||||||||||||||||||||||||||||||    
3261412 ctaacattaatattaactaat-aaaaaaatagatgttaaaaatagaatgtttttggcacttttt 3261474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University