View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6086_low_27 (Length: 221)
Name: NF6086_low_27
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6086_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 39494269 - 39494184
Alignment:
| Q |
18 |
tctttaatcattttaacgttgaatgtcttagtcaagttgaaaatcttcactagttttcatatctcacattgttgttactaatttgg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39494269 |
tctttaatcattttaacgttgaatgtcttagtcaagttgaaaatcttcactagttttcatatctcacattgttgttactaatttgg |
39494184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 39494123 - 39494071
Alignment:
| Q |
169 |
ctcgttttagtggtttatttataatattatgtcaatgtaaagtgacgatcatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39494123 |
ctcgttttagtggtttatttataatattatgtcaatgtaaagtgacgatcatt |
39494071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 39426347 - 39426287
Alignment:
| Q |
20 |
tttaatcattttaacgttgaatgtcttagtcaagttgaaaatcttcactagttttcatatc |
80 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
39426347 |
tttaatcatgttaatcttgtatgtcttagtcaacttgaaaatcttcactagttttaatatc |
39426287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 39130909 - 39130949
Alignment:
| Q |
18 |
tctttaatcattttaacgttgaatgtcttagtcaagttgaa |
58 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
39130909 |
tctttaatcattttaatgttgtaggtcttagtcaagttgaa |
39130949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University