View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6086_low_27 (Length: 221)

Name: NF6086_low_27
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6086_low_27
NF6086_low_27
[»] chr2 (4 HSPs)
chr2 (18-103)||(39494184-39494269)
chr2 (169-221)||(39494071-39494123)
chr2 (20-80)||(39426287-39426347)
chr2 (18-58)||(39130909-39130949)


Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 39494269 - 39494184
Alignment:
18 tctttaatcattttaacgttgaatgtcttagtcaagttgaaaatcttcactagttttcatatctcacattgttgttactaatttgg 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39494269 tctttaatcattttaacgttgaatgtcttagtcaagttgaaaatcttcactagttttcatatctcacattgttgttactaatttgg 39494184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 39494123 - 39494071
Alignment:
169 ctcgttttagtggtttatttataatattatgtcaatgtaaagtgacgatcatt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
39494123 ctcgttttagtggtttatttataatattatgtcaatgtaaagtgacgatcatt 39494071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 39426347 - 39426287
Alignment:
20 tttaatcattttaacgttgaatgtcttagtcaagttgaaaatcttcactagttttcatatc 80  Q
    ||||||||| ||||  ||| ||||||||||||| ||||||||||||||||||||| |||||    
39426347 tttaatcatgttaatcttgtatgtcttagtcaacttgaaaatcttcactagttttaatatc 39426287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 39130909 - 39130949
Alignment:
18 tctttaatcattttaacgttgaatgtcttagtcaagttgaa 58  Q
    |||||||||||||||| |||| | |||||||||||||||||    
39130909 tctttaatcattttaatgttgtaggtcttagtcaagttgaa 39130949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University