View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6086_low_30 (Length: 217)
Name: NF6086_low_30
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6086_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 2677713 - 2677898
Alignment:
| Q |
17 |
cacttgcaaagttgttagattctggaaacttggtcttgatggatggaaagaaccatgattctaatagttacatatggcaaagctttgattatcctacaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2677713 |
cacttgcaaagttgttagattctggaaacttggtcttgatggatggaaagaaccatgattctaatagttacatatggcaaagctttgattatcctacaga |
2677812 |
T |
 |
| Q |
117 |
cacaatgttacctggcatgaagttgggttgggataaggcctcaggtcttgatagatatttgacatcatggaagagtgctgatgatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2677813 |
cacaatgttacctggcatgaagttgggttgggataaggcctcaggtcttgatagatatttgacatcatggaagagtgctgatgatg |
2677898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 3052799 - 3052682
Alignment:
| Q |
17 |
cacttgcaaagttgttagattctggaaacttggtcttgatggatggaaaga--accatgattctaatagttacatatggcaaagct----ttgattatcc |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||| ||| | ||||||||| || || || ||||||||||| |||||||||| |
|
|
| T |
3052799 |
cacttgcaaaaatgttagattctggaaacttggtcttgaaggatggagagattaacatgattcttctaattgcacatggcaaagctttgattgattatcc |
3052700 |
T |
 |
| Q |
111 |
tacagacacaatgttacc |
128 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3052699 |
aacagacacaatgttacc |
3052682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University