View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6086_low_32 (Length: 210)
Name: NF6086_low_32
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6086_low_32 |
 |  |
|
| [»] chr1 (190 HSPs) |
 |  |
|
| [»] chr8 (177 HSPs) |
 |  |
|
| [»] chr5 (179 HSPs) |
 |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |
|
| [»] chr7 (187 HSPs) |
 |  |
|
| [»] chr6 (123 HSPs) |
 |  |
|
| [»] chr4 (207 HSPs) |
 |  |
|
| [»] chr2 (149 HSPs) |
 |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |
|
| [»] scaffold0272 (4 HSPs) |
 |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |
|
| [»] scaffold0213 (2 HSPs) |
 |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |
|
| [»] scaffold2010 (1 HSPs) |
 |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |
|
| [»] scaffold0951 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |
|
| [»] scaffold0693 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold1301 (1 HSPs) |
 |  |
|
| [»] scaffold0279 (1 HSPs) |
 |  |  |
|
| [»] scaffold0236 (1 HSPs) |
 |  |  |
|
| [»] scaffold0032 (2 HSPs) |
 |  |  |
|
| [»] scaffold0028 (2 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 204)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 3398501 - 3398348
Alignment:
| Q |
1 |
tatctggttatttacttcttaaatgcaatgcagactcgatctaaactaattatgacaacctattattactactaataagacctaacactatttatgactt |
100 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3398501 |
tatctggttatttatttcttaaatacaatgcagactcgatctaaactaattatgacaacctattattactactaataagacctaacactatttatgactt |
3398402 |
T |
 |
| Q |
101 |
tatgactattattaatagatgctaatcataattctcaatgcacaattaaatgaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3398401 |
tatgactattattaatagatgctaatcataattctcaatgcacaattaaatgaa |
3398348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 16 - 154
Target Start/End: Complemental strand, 3387066 - 3386928
Alignment:
| Q |
16 |
ttcttaaatgcaatgcagactcgatctaaactaattatgacaacctattattactactaataagacctaacactatttatgactttatgactattattaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3387066 |
ttcttaaatgcaatgcagactcgatctaaactaattatgacaacctattattactactaataagacctaacactatttatcactttatgactattattac |
3386967 |
T |
 |
| Q |
116 |
tagatgctaatcataattctcaatgcacaattaaatgaa |
154 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
3386966 |
tagatgctaatgataattctcaatgcaaaattaaatgaa |
3386928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 30761120 - 30761058
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761120 |
aaataaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
30761058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 2118706 - 2118768
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2118706 |
aaatgaaggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
2118768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 33576724 - 33576667
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33576724 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
33576667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 47943779 - 47943718
Alignment:
| Q |
149 |
aatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47943779 |
aatgtaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
47943718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 9633712 - 9633656
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9633712 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
9633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 19914475 - 19914531
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19914475 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
19914531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 25126312 - 25126256
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25126312 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25126256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 31117619 - 31117675
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31117619 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31117675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 41282160 - 41282105
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41282160 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41282105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 45760546 - 45760491
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45760546 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45760491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 27766511 - 27766573
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27766511 |
aaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 144 - 210
Target Start/End: Complemental strand, 28097748 - 28097682
Alignment:
| Q |
144 |
aattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28097748 |
aattaaaaaaaggcttaattccacttttggacccctatcttttcaaaagttgcggttatggacccct |
28097682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 32205162 - 32205108
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32205162 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
32205108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 36441636 - 36441582
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36441636 |
gcttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
36441582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 47530660 - 47530598
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47530660 |
aaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 2239225 - 2239282
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2239225 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
2239282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 2239545 - 2239488
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2239545 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2239488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 3384302 - 3384249
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3384302 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacc |
3384249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 8315396 - 8315339
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
8315396 |
aaggcttaattgcacttttgaacccctattttttcaaaagttgcggttatagacccct |
8315339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 8727915 - 8727968
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8727915 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8727968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 9079802 - 9079855
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9079802 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9079855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 17916398 - 17916341
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17916398 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17916341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 28097415 - 28097472
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28097415 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
28097472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 33621864 - 33621921
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33621864 |
aaggcttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
33621921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 37182002 - 37182059
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37182002 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37182059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 41223511 - 41223568
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41223511 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatagacccct |
41223568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 41722297 - 41722244
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41722297 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgtggttatggaccc |
41722244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 45743897 - 45743954
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45743897 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45743954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 50033556 - 50033499
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50033556 |
aaggcttaattgcacttttggacccctatcttttcaaaggttgcggttatggacccct |
50033499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 52916857 - 52916914
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52916857 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52916914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 53192112 - 53192169
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53192112 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53192169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 53531804 - 53531861
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53531804 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
53531861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 8313948 - 8314004
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8313948 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8314004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 10864114 - 10864170
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10864114 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10864170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 19391637 - 19391693
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19391637 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 19392017 - 19391961
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19392017 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 19914786 - 19914730
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19914786 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19914730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 27748557 - 27748501
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27748557 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27748501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 27766831 - 27766775
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27766831 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 28964152 - 28964208
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28964152 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28964208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 29168732 - 29168784
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29168732 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29168784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 38511971 - 38511915
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38511971 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatagacccct |
38511915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 42230345 - 42230289
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42230345 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42230289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 44177287 - 44177343
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44177287 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44177343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 44183971 - 44184027
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44183971 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 44624540 - 44624484
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44624540 |
aggcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
44624484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 44895962 - 44895906
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44895962 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44895906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 47943458 - 47943514
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47943458 |
aggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
47943514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 49997970 - 49997914
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49997970 |
aggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
49997914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 53532120 - 53532064
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53532120 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53532064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 787099 - 787154
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
787099 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
787154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 2119027 - 2118976
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2119027 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
2118976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 3212465 - 3212410
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3212465 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3212410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 17483561 - 17483616
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17483561 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
17483616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 17483871 - 17483816
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17483871 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
17483816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 22202484 - 22202539
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22202484 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
22202539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 27857448 - 27857393
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27857448 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27857393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 32507925 - 32507980
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
32507925 |
aaggcttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
32507980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 36373860 - 36373805
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
36373860 |
aaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
36373805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 44184284 - 44184229
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44184284 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 47530339 - 47530394
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47530339 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 27748241 - 27748299
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27748241 |
gaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27748299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 44177597 - 44177543
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44177597 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
44177543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 51213307 - 51213361
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51213307 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccc |
51213361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 9153475 - 9153528
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
9153475 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggac |
9153528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 26494683 - 26494736
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
26494683 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
26494736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 33622177 - 33622124
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33622177 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
33622124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 38511659 - 38511712
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
38511659 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
38511712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 41722052 - 41722109
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
41722052 |
aaggcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
41722109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 42465689 - 42465746
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
42465689 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggtcccct |
42465746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 47722147 - 47722204
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
47722147 |
aaggtttaattgcacttttgaacccctatctttccaaaagttgcggttatggatccct |
47722204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 257750 - 257694
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
257750 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
257694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 2205540 - 2205592
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2205540 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
2205592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 9630767 - 9630823
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||| |||||| |
|
|
| T |
9630767 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
9630823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 11961864 - 11961920
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
11961864 |
aggcttaattgcacttttggacccctaacttttcaaaagttgcggttacggacccct |
11961920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 12881234 - 12881290
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
12881234 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
12881290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 12881529 - 12881473
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
12881529 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
12881473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 27448813 - 27448869
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
27448813 |
aggcttaattgtacttttgaacccctatctttccaaaagttgcggttatggtcccct |
27448869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 28964468 - 28964412
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28964468 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28964412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 30200419 - 30200471
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30200419 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30200471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 33252795 - 33252743
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33252795 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
33252743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 41281844 - 41281900
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41281844 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
41281900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 44895648 - 44895704
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
44895648 |
aggcttaattgcacttttggacccctatctttttaaaagttgcgattatggacccct |
44895704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 51214473 - 51214417
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
51214473 |
aggcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
51214417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 204
Target Start/End: Complemental strand, 52613634 - 52613586
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52613634 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
52613586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 53192426 - 53192374
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
53192426 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
53192374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 53422092 - 53422144
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53422092 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53422144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 5577246 - 5577191
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5577246 |
ggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
5577191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 9792919 - 9792974
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
9792919 |
aaggtttaattgcacttttgaacccctttcttttcaaaagttgcggttatagaccc |
9792974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 32508232 - 32508177
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
32508232 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
32508177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 5576926 - 5576988
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
5576926 |
aaatcaaggcttaattgtacttttggacccctatctttttaaaagttgcggttatgcacccct |
5576988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 20982573 - 20982523
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
20982573 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20982523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 27719997 - 27719951
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27719997 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
27719951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 27984139 - 27984189
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
27984139 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatgga |
27984189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 31869507 - 31869453
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31869507 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
31869453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 45760229 - 45760287
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45760229 |
gaaggcttaattgcactttttgacctctatctttccaaaagttgcggttatggacccct |
45760287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 47423442 - 47423392
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
47423442 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
47423392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 7858277 - 7858220
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
7858277 |
aaggcttaattgcacttttggatccctatctttccaaaagttgcggttatggccccct |
7858220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 11963040 - 11962983
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
11963040 |
aaggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
11962983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 21842026 - 21841969
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
21842026 |
aaggcttaattgcacttttagacctctatcttttcaaaagttgcggttatggccccct |
21841969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 25053897 - 25053848
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
25053897 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
25053848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 27984446 - 27984393
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
27984446 |
aggcttaattacacttttggacccctatctttccaaaagttgcggttatggacc |
27984393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 33576405 - 33576462
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
33576405 |
aaggtttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
33576462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 40082211 - 40082260
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
40082211 |
aggcttaattgcacttttggacacctatcttttcaaaagttgcggttatg |
40082260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 41223824 - 41223771
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
41223824 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
41223771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 42230031 - 42230088
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
42230031 |
aaggcttaattgcacttttggacctctatctttccaaaagttgcggttatggatccct |
42230088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 47423145 - 47423202
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
47423145 |
aaggtttaattgcacttttggacccttatcttttcaaaagttgcggttatggccccct |
47423202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 51336889 - 51336938
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
51336889 |
aggcttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
51336938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 51843113 - 51843060
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
51843113 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51843060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 7818936 - 7818984
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7818936 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggac |
7818984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 10439590 - 10439538
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10439590 |
ttaattgcatttttggacccttatcttttcaaaagttgcggttatggacccct |
10439538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 150 - 210
Target Start/End: Complemental strand, 10864437 - 10864377
Alignment:
| Q |
150 |
atgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| |||||||||| |||||| |||||| |
|
|
| T |
10864437 |
atgacggcttaattgcacttttggacccctatctttccaaaagttgcagttatgaacccct |
10864377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 21841726 - 21841782
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
21841726 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggccccct |
21841782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 24636349 - 24636401
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
24636349 |
aggcttaattgtacttttggacccctatcttttcaaaagttgtggttatggac |
24636401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29169042 - 29168986
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
29169042 |
aggcttaattgcacttttagacatctatcttttcaaaagttgcggttatggacccct |
29168986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 30200728 - 30200672
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
30200728 |
aggcttaattgcacttttagactcctatctttccaaaagttgcggttatggacccct |
30200672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 32204847 - 32204903
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||| |||||||||||| |
|
|
| T |
32204847 |
aggcttaattgcacttttggacctctatctttccaaaagttgcgcttatggacccct |
32204903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 37182313 - 37182257
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| || || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37182313 |
aggcttaattgcggttatggacccctatcttttcaaaagttgcggttatggacccct |
37182257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 45744213 - 45744157
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | | |||||||| |||||||||||||||||||||||| |
|
|
| T |
45744213 |
aggcttaattgcacttttggatctctatctttccaaaagttgcggttatggacccct |
45744157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 52917633 - 52917577
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
52917633 |
aggcttaattgcacttttgggcccctatctttccaaaagttgcggttatggatccct |
52917577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 9793234 - 9793179
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| || | ||||||||||||| |||||||||||||||| |
|
|
| T |
9793234 |
aaggcttaattgcacttttggactcttatcttttcaaaaattgcggttatggaccc |
9793179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 20982280 - 20982335
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20982280 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
20982335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 49997655 - 49997710
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
49997655 |
ggcttaattgcacttttggacccctatttttccaaaagttgcggttatggatccct |
49997710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 51842801 - 51842856
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| | | ||||||||||||||||||||||||||||||||| |
|
|
| T |
51842801 |
ggcttaattgcacttttagatctctatcttttcaaaagttgcggttatggacccct |
51842856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 53190964 - 53191011
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
53190964 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
53191011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 53191276 - 53191221
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
53191276 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggatccct |
53191221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 2711699 - 2711749
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
2711699 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
2711749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 24393688 - 24393746
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
24393688 |
aaggcttaattgcacttttggaccccctatctttttaaaagttgtggttatggacccct |
24393746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 31577731 - 31577681
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
31577731 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacc |
31577681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 40082505 - 40082455
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
40082505 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
40082455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 51860333 - 51860386
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
51860333 |
aggcttaattgcatttttggacccctatcttttc-aaagttgcggttatggaccc |
51860386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 787411 - 787358
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| | |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
787411 |
cttaattgcacttttggatccctatttttccaaaagttgcggttatggacccct |
787358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 5153779 - 5153836
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
5153779 |
aaggtttaattgcacttttggacctctatctttttaaaagttacggttatggacccct |
5153836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 7857980 - 7858029
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
7857980 |
aggcttaattgtacttttggacccctatcttttcaaaagttgcggctatg |
7858029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 25782968 - 25782911
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| || | ||||||| |||||||||||||||||||||||| |
|
|
| T |
25782968 |
aaggcttaattgcacttttagacacttatctttccaaaagttgcggttatggacccct |
25782911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 32459098 - 32459041
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| | | |||||||| |||||||||||||||||||||||| |
|
|
| T |
32459098 |
aaggcttaattgcatttttggatctctatctttccaaaagttgcggttatggacccct |
32459041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 36017076 - 36017019
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
36017076 |
aaggcttaatttcacttttagacccctatctttccaaaagttgcggttatgcacccct |
36017019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 42465984 - 42465935
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
42465984 |
aggcttaattgcacttttgaacctcaatctttccaaaagttgcggttatg |
42465935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 5154094 - 5154042
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
5154094 |
ggcttaattgcacttttggaccactatttttccaaaagttgcggttatggacc |
5154042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 9588428 - 9588372
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||| |||||||||||| |
|
|
| T |
9588428 |
aggcttaattgcacttttgggcccttatcttttcaaaagttgcatttatggacccct |
9588372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 10439285 - 10439341
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| |||| |||| |||||||| |||||||||||||| |
|
|
| T |
10439285 |
aggcttaattgcacttttggacctctatttttttaaaagttgtggttatggacccct |
10439341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 14015456 - 14015408
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||| || ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14015456 |
ggcttaagtgtacttttggacccctatcttttcaaaagttgcggttatg |
14015408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 21690183 - 21690127
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
21690183 |
aggcttaattgcacttttgcccccctatctttccaaaagttacggttatgggcccct |
21690127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 22202793 - 22202741
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
22202793 |
ttaattgcacttttggatccctatcttttcaaaagttacggttatggatccct |
22202741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 24394004 - 24393952
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
24394004 |
gcttaattgcacttttggattcctatcttttcaaaagttgtggttatggaccc |
24393952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 208
Target Start/End: Complemental strand, 24636661 - 24636601
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||| ||| |||||||| ||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
24636661 |
aaataaagacttaattgtacttttggatccttatcttttcaaaagttgcggttatggaccc |
24636601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 25782652 - 25782708
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
25782652 |
aggcttaattgcactttttgacccctatttttccaaaagttgcggttatgaacccct |
25782708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 31577423 - 31577474
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
31577423 |
ttaattgcacttttga-cccctatctttttaaaaattgcggttatggacccct |
31577474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 32593783 - 32593839
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||| |||| ||||||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
32593783 |
aaataaaggtttaattgcacttttggacctctatcttttaaaaagttgcggttatgg |
32593839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 33252483 - 33252539
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
33252483 |
aggcttaattgtacttttggacccctatctttctaaaagttgcgattatggacccct |
33252539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 43679015 - 43678967
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
43679015 |
ggcttaattgcacttttggacacctatattttcaaaagttgcggttatg |
43678967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 46934302 - 46934246
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
46934302 |
aggcttaattgcacttttggccccctatctttccaaaagttgcgattatggccccct |
46934246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 47722464 - 47722412
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||| | ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
47722464 |
aggcttaattgtatttttggactcctatcttttcaaaagttgcggttatggac |
47722412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 48160486 - 48160538
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48160486 |
ttaattgcatatttggacccctatcttttcaaaagttgcggttatggatccct |
48160538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 54718163 - 54718115
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
54718163 |
aaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54718115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 204
Target Start/End: Complemental strand, 26012983 - 26012932
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||| ||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
26012983 |
aaggtttaattgcatttttggactcctatcttttcaaaagttgcggttatgg |
26012932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 33933681 - 33933626
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
33933681 |
ggcttaattgcaattttggccccctatctttccaaaagttgcggttatagacccct |
33933626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 36441482 - 36441533
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
36441482 |
ggcttaattgcacttttggactcctatctttctaaaagttgcggttatggac |
36441533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 46934038 - 46934081
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46934038 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcg |
46934081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 203
Target Start/End: Complemental strand, 49859763 - 49859716
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||| ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
49859763 |
gcttaattgtacttttggacctctatcttttcaaaagttgcggttatg |
49859716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 160 - 210
Target Start/End: Original strand, 3212158 - 3212208
Alignment:
| Q |
160 |
aattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
3212158 |
aattgcacttttggacccctatctttctaaaagttgcggttatgaacccct |
3212208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 14003810 - 14003852
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
14003810 |
ggcttaattgcacttttgaacccttattttttcaaaagttgcg |
14003852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 39905730 - 39905776
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
39905730 |
cttaattgcactttttgacctctatcttttcaaaagttgcggttatg |
39905776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 47284612 - 47284550
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||| |||||||||||||||| |||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
47284612 |
aaatcaaggtttaattgcacttttgaccccctatctttttaaaagttgcgattttggtcccct |
47284550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 201
Target Start/End: Original strand, 54717165 - 54717211
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
54717165 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54717211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 9153788 - 9153735
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| || ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
9153788 |
cttaattgcacttttggactcctatctttctaaaagttacggttatggacccct |
9153735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 26012683 - 26012740
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
26012683 |
aaggcttaattgcacttttagatccctatcttttcaaaagttacggctatggccccct |
26012740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 30632434 - 30632397
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30632434 |
ttaattgcacttttgatcccctatcttttcaaaagttg |
30632397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 31869194 - 31869250
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||| ||||||||||||||||||||||| |
|
|
| T |
31869194 |
aaggcttaattgcacttttggaccc-tatttttctaaaagttgcggttatggacccct |
31869250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 34942740 - 34942785
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
34942740 |
ttaattgtacttttggactcctatcttttcaaaagttgcggttatg |
34942785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 36567190 - 36567133
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| | |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
36567190 |
aaggcttaattgcatttttggcctcctaacttttcaaaagttgcggttatggccccct |
36567133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 195
Target Start/End: Original strand, 54716475 - 54716516
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54716475 |
aggcttaattgcacttttggccccctatcttttcaaaagttg |
54716516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 257441 - 257493
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| | ||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
257441 |
ttaattgtatttttggactcctatcttttcaaaagttgcggttatgaacccct |
257493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 2205838 - 2205794
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||||||||| |
|
|
| T |
2205838 |
ttaattgcacttttggacccctatctttccaaaaattgcggttat |
2205794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 14004148 - 14004108
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
14004148 |
aggcttaattgcacttttggatccctatcttttcaaaagtt |
14004108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 14133639 - 14133695
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| |||||||||| |||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
14133639 |
aggcttagttgcactttttgacccctatctttccaaaacttgcggttatggccccct |
14133695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 14133934 - 14133879
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
14133934 |
aggcttaatt-cacttttggacccctatctttccaaaagttgtggttatggccccct |
14133879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 25053606 - 25053658
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | || ||| |||||||||||||||||||||| ||||| |
|
|
| T |
25053606 |
ttaattgcacttttggatccttattttttcaaaagttgcggttatggccccct |
25053658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 27449268 - 27449224
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
27449268 |
ttaattgcacttttgaactcctatcttttcaaaggttgcgtttat |
27449224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 30432943 - 30432899
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
30432943 |
ttaattacacttttgaatcactatcttttcaaaagttgcggttat |
30432899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 32458782 - 32458834
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| || ||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32458782 |
ttaattgcatttttggactcctatctttccaaaagttgcggttatagacccct |
32458834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 32594079 - 32594027
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||||| ||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
32594079 |
ttaattgtacttttggacctctatcttttcaaaagttgtggttatggccccct |
32594027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 200
Target Start/End: Original strand, 44701816 - 44701860
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggtt |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
44701816 |
gcttaattgcacttttggccccctatctttccaaaagttgcggtt |
44701860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 47360520 - 47360484
Alignment:
| Q |
174 |
acccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47360520 |
acccctatctttttaaaagttgcggttatggacccct |
47360484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 51860622 - 51860586
Alignment:
| Q |
174 |
acccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51860622 |
acccctatctttttaaaagttgcggttatggacccct |
51860586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 53764573 - 53764617
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
53764573 |
aaggcttaattgcacttttggccccctatctttccaaaagttgcg |
53764617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 193
Target Start/End: Original strand, 14904441 - 14904480
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagt |
193 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
14904441 |
aggcttaattgcacttttggacccctatctttccaaaagt |
14904480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 31117932 - 31117877
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||| |||| ||| |||||||||||||| |
|
|
| T |
31117932 |
ggcttaattgcaattttggacccatatctttttaaaaattgtggttatggacccct |
31117877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 197
Target Start/End: Complemental strand, 47922399 - 47922361
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47922399 |
ttaattgcactttt-aacccctatcttttcaaaagttgcg |
47922361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 50033313 - 50033368
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||||||| |||||||||| |||| |
|
|
| T |
50033313 |
ggcttaattgcacttttagacctctatctttccaaaagttacggttatggatccct |
50033368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 50725061 - 50725018
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
50725061 |
aggcttaattgcacttttggccccctatcttttcaaaacttgcg |
50725018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 50787789 - 50787832
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
50787789 |
aggcttaattgcacttttggccccctatcttttcaaaacttgcg |
50787832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 21689943 - 21689985
Alignment:
| Q |
168 |
ttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
21689943 |
ttttggacccctatctttccaaaagttgcggttatggccccct |
21689985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 194
Target Start/End: Complemental strand, 8728227 - 8728186
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
8728227 |
aaggtttaattgcacttttggacccctatctttccaaaagtt |
8728186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 194
Target Start/End: Complemental strand, 9080114 - 9080073
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
9080114 |
aaggtttaattgcacttttggacccctatctttccaaaagtt |
9080073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 34943030 - 34942974
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||| |||||||| ||||| |
|
|
| T |
34943030 |
aaggcttaattgcacttttgga-tcctatctttttaaaagttgtggttatggtcccct |
34942974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 43001940 - 43001883
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| ||||| || ||| ||||| |
|
|
| T |
43001940 |
aaggcttaattgcacttttggccccctatctttttaaaaattgcgattttggccccct |
43001883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 49859528 - 49859573
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
49859528 |
ttaattgcacttttggactcctatctttctaaaagttgcggttatg |
49859573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 53422392 - 53422335
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||| ||||||| |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
53422392 |
aaggtttaattacacttttagacccctatctttctaaaagttgcggttatggatccct |
53422335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 54716822 - 54716765
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||| || ||| ||||| |
|
|
| T |
54716822 |
aaggcttaattgcacttttggtcacctatctttttaaaagttgcgattttggtcccct |
54716765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 46984821 - 46984873
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||||| |||||| |||| ||||||||||||| ||||| |
|
|
| T |
46984821 |
aggcttaattgcacttttgtctccctatgttttaaaaagttgcggttttggac |
46984873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 53568640 - 53568596
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
53568640 |
aaggtttaattgcacttttgaccccttatctttttaaaagttgcg |
53568596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 3e-25; HSPs: 190)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 52143485 - 52143423
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52143485 |
aaatgaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52143423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 42406881 - 42406938
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42406881 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
42406938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 11018718 - 11018660
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11018718 |
gaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11018660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 32341807 - 32341750
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32341807 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
32341750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 22204304 - 22204360
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22204304 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22204360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 23341963 - 23342019
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23341963 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23342019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 45884947 - 45885003
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45884947 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45885003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 6491729 - 6491674
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491729 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6491674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 8770461 - 8770516
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8770461 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8770516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 13791888 - 13791833
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13791888 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
13791833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 143 - 210
Target Start/End: Complemental strand, 29795019 - 29794952
Alignment:
| Q |
143 |
caattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29795019 |
caattaaatctaggcataattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29794952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 38622716 - 38622661
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38622716 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38622661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 52149827 - 52149772
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52149827 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 14738 - 14795
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14738 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
14795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 11018399 - 11018456
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11018399 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11018456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 15161613 - 15161556
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15161613 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15161556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 21727926 - 21727873
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21727926 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21727873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 23342276 - 23342219
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23342276 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23342219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 23356691 - 23356748
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23356691 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23356748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 26861272 - 26861329
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26861272 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
26861329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 36139364 - 36139421
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36139364 |
aaggtttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
36139421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 39427409 - 39427466
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39427409 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
39427466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 40355846 - 40355903
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40355846 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40355903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 47113702 - 47113645
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47113702 |
aaggcttaattgcacttttggacccctatcttttcaaaatttgcggttatggacccct |
47113645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 6809067 - 6809123
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6809067 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
6809123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 8028959 - 8029015
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8028959 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
8029015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 8774297 - 8774353
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8774297 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8774353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 11204506 - 11204562
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11204506 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20224390 - 20224334
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20224390 |
aggcttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
20224334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20471726 - 20471670
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20471726 |
aggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20471670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 20559811 - 20559867
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20559811 |
aggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20559867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20596177 - 20596121
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20596177 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20596121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 27855563 - 27855611
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27855563 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
27855611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 37028927 - 37028983
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37028927 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
37028983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 43914894 - 43914838
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43914894 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
43914838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 44846917 - 44846973
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44846917 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
44846973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 45885263 - 45885207
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45885263 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45885207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 52149520 - 52149572
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52149520 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 2371490 - 2371435
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2371490 |
ggcttaattgcacttttggacccctatcttttaaaaagttgcggttatggacccct |
2371435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 6183295 - 6183240
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6183295 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
6183240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 7598921 - 7598866
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7598921 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
7598866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 9053723 - 9053660
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9053723 |
aaattaaggcttaattgcacttttggaccccctatcttttcaaaagttgcggttatggacccct |
9053660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 9058166 - 9058221
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9058166 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
9058221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 9517250 - 9517305
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9517250 |
ggcttaattgctcttttggacccctatcttttcaaaagttgcggttatggacccct |
9517305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 11052210 - 11052155
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11052210 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11052155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 28503449 - 28503394
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28503449 |
ggcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
28503394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 32341495 - 32341550
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32341495 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32341550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 42407198 - 42407143
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42407198 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42407143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 2372732 - 2372670
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2372732 |
aaataaaggcttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2372670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 2383339 - 2383401
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2383339 |
aaataaaggcttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2383401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 49227113 - 49227175
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49227113 |
aaataaaggtttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
49227175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 922478 - 922421
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
922478 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
922421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 6491414 - 6491471
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
6491414 |
aaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatgaacccct |
6491471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 11204814 - 11204757
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11204814 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 12690019 - 12690076
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12690019 |
aaggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
12690076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 143 - 208
Target Start/End: Complemental strand, 25098454 - 25098390
Alignment:
| Q |
143 |
caattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||| ||| |||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
25098454 |
caattaaattaag-cttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
25098390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 27396841 - 27396784
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27396841 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27396784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 29794691 - 29794748
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
29794691 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29794748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 43914576 - 43914633
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
43914576 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
43914633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 45680093 - 45680146
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45680093 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
45680146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 47113390 - 47113443
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47113390 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47113443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 52233429 - 52233486
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
52233429 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
52233486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 7598608 - 7598664
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
7598608 |
aggcttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
7598664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 9517556 - 9517504
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9517556 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
9517504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 11051895 - 11051951
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
11051895 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttattgacccct |
11051951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 15161296 - 15161352
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
15161296 |
aggcttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
15161352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 16490973 - 16491029
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16490973 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatgaacccct |
16491029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 23357003 - 23356955
Alignment:
| Q |
159 |
taattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23357003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
23356955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 30288175 - 30288231
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
30288175 |
aggcttaattgcacttttggacccctatctttccagaagttgcggttatggacccct |
30288231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 32558215 - 32558267
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32558215 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32558267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 39427727 - 39427671
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39427727 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39427671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 45664454 - 45664398
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
45664454 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
45664398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 46320990 - 46320934
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
46320990 |
aggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
46320934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 52143168 - 52143220
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52143168 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52143220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 2371177 - 2371232
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2371177 |
ggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
2371232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 3264000 - 3264055
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3264000 |
ggcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
3264055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 6182982 - 6183037
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
6182982 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
6183037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 22075664 - 22075617
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22075664 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
22075617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 23793095 - 23793044
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
23793095 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
23793044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 31797063 - 31797118
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31797063 |
aggcttaattgcacttttggacccctatctttccaaaaattgcggttatggacccc |
31797118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 37029241 - 37029186
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
37029241 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
37029186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 47764091 - 47764146
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
47764091 |
ggcttaattgcacttttggacctctattttttcaaaagttgcggttatggacccct |
47764146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 51272677 - 51272732
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
51272677 |
ggcttaattgtacttttgaacctctatcttttcgaaagttgcggttatggacccct |
51272732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 16491295 - 16491233
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
16491295 |
aaataaaggcttaattgcacttttggacctttatcttttcaaaagttgcggttatggatccct |
16491233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 206
Target Start/End: Original strand, 20224079 - 20224129
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
20224079 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
20224129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 22071166 - 22071216
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22071166 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
22071216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 41585597 - 41585543
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
41585597 |
gcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
41585543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 46320676 - 46320726
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
46320676 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatgga |
46320726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 8535831 - 8535774
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8535831 |
aaggtttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8535774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 8601070 - 8601013
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8601070 |
aaggtttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8601013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 8770776 - 8770723
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8770776 |
ggcttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
8770723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 14460303 - 14460356
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
14460303 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
14460356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 19830426 - 19830369
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
19830426 |
aaggtttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
19830369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 20017692 - 20017639
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
20017692 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcgtttatggac |
20017639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 28503133 - 28503190
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28503133 |
aaggcttaattacacttttagacctctatcttttcaaaagttgcggttatggacccct |
28503190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 29704619 - 29704672
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
29704619 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatagacccct |
29704672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 145 - 210
Target Start/End: Original strand, 34988080 - 34988145
Alignment:
| Q |
145 |
attaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| || |||||||| ||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34988080 |
attaaataaaagcttaattatacttttggacccctatcttttcaaaagttgcggttatgaacccct |
34988145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 34988397 - 34988344
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34988397 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
34988344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 36139664 - 36139615
Alignment:
| Q |
161 |
attgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36139664 |
attgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36139615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 40815179 - 40815130
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
40815179 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttatgg |
40815130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 45012630 - 45012679
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
45012630 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
45012679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 161 - 206
Target Start/End: Complemental strand, 47764398 - 47764353
Alignment:
| Q |
161 |
attgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47764398 |
attgtacttttgaacccctatcttttcaaaagttgcggttatggac |
47764353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 49056437 - 49056380
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
49056437 |
aggcttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 921752 - 921808
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
921752 |
aggcttaattacacttttgaacctctatctttccaaaagttgcggttatgaacccct |
921808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 1480555 - 1480503
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
1480555 |
ttaattgcacttttgtacccctatctttccaaaagttgcggttatggatccct |
1480503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 1712368 - 1712412
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1712368 |
aaggcttaattgcacttttgaccccctatcttttcaaaagttgcg |
1712412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 3383963 - 3384011
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
3383963 |
aggcttaattgcacttttggacctctatcttttcaaaagttgcggttat |
3384011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 6809379 - 6809327
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6809379 |
ttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
6809327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 20471413 - 20471469
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20471413 |
aggcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20471469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20560124 - 20560068
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20560124 |
aggcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20560068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 23208307 - 23208363
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
23208307 |
aggcttaattatacttttggactcctatcttttcaaaagttgcggttatggacccct |
23208363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 26435003 - 26434955
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
26435003 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
26434955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 38622402 - 38622454
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
38622402 |
aggcttaattgcacttttggacccctatcttttcagaagttgcagttatggac |
38622454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 43677102 - 43677158
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
43677102 |
aggcttaattgcacttttggatccctatctttccaaaagttgcggttatgaacccct |
43677158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 49056123 - 49056179
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
49056123 |
ggcttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 4243441 - 4243390
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||||||||||||| |
|
|
| T |
4243441 |
aggcttaattgcacttttggatccctatctttttaaaagttgcggttatgga |
4243390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 18589849 - 18589904
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
18589849 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggtcccct |
18589904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 22204619 - 22204568
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
22204619 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
22204568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 26811452 - 26811495
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26811452 |
aggcttaattgcacttttgaccccctatcttttcaaaagttgcg |
26811495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 30294870 - 30294925
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
30294870 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggatccct |
30294925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 204
Target Start/End: Original strand, 36230550 - 36230601
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
36230550 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
36230601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 40356158 - 40356107
Alignment:
| Q |
159 |
taattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
40356158 |
taattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
40356107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 43677414 - 43677360
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
43677414 |
ggcttaattgcacttttggaccc-tatcttttcaaaagttgcggttatgaacccct |
43677360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 49227429 - 49227374
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
49227429 |
ggcttaattgcacttttggacccctaactttccaaaagtcgcggttatggacccct |
49227374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 9332906 - 9332956
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||||||||||||||||| |
|
|
| T |
9332906 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9332956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 9356679 - 9356729
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||||||||||||||||| |
|
|
| T |
9356679 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9356729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 10279991 - 10279941
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
10279991 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgg |
10279941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 25820868 - 25820814
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
25820868 |
aaggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacc |
25820814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 40618729 - 40618779
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
40618729 |
aggcttaattgcacttttggacccctatatttccaaaagttgcggttatgg |
40618779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 12071642 - 12071695
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
12071642 |
aaggcttaattacacttttggacccctatctttcaaaaagttgcggttatggac |
12071695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 13791574 - 13791631
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||| ||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
13791574 |
aaggtttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
13791631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 14460617 - 14460560
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14460617 |
aaggtttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
14460560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 26434712 - 26434757
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
26434712 |
ttaattgcacttttgaacccctatctttccaaaagttacggttatg |
26434757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 51272993 - 51272936
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
51272993 |
aaggcttaattgcacttttagacccttatctttcaaaaagttgcggttatggacccct |
51272936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 4243133 - 4243185
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4243133 |
ttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
4243185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 15911670 - 15911714
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15911670 |
aaggcttaattgcacttttggccccctatcttttcaaaagttgcg |
15911714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 20287766 - 20287822
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
20287766 |
aggcttaattgcacttttggaaccctacctttccaaaagttgcggttatgaacccct |
20287822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 20359308 - 20359260
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||| ||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
20359308 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
20359260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 20551662 - 20551710
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||| ||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
20551662 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
20551710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 23208620 - 23208564
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||| ||||||| |||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
23208620 |
aggcttagttgtacttttggacccctatctttccaaaagttgcggttacggacccct |
23208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 23792780 - 23792832
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||| |||||||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
23792780 |
ggcttaattacacttttggacacctatctttccaaaagttgcggttatggacc |
23792832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 26932581 - 26932624
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26932581 |
aaggcttaattgcacttttga-cccctatcttttcaaaagttgcg |
26932624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 42589715 - 42589660
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
42589715 |
aggcttaattacacttttggacccctatcttttc-aaagttgcggttatggccccct |
42589660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 210
Target Start/End: Complemental strand, 45680396 - 45680348
Alignment:
| Q |
162 |
ttgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
45680396 |
ttgcacttttggatccctattttttcaaaagttgcggttatggacccct |
45680348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 52233726 - 52233670
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| | |||||| |||||||||||||||||||||| ||||| |
|
|
| T |
52233726 |
aggcttaattgcatttttggatccctatattttcaaaagttgcggttatggtcccct |
52233670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 15054 - 14997
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaa---agttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15054 |
aggcttaattgcatttttggacccctatcttttcaaaagtagttgcggttatggaccc |
14997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 8774610 - 8774555
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||||||| |||||| |||||| |
|
|
| T |
8774610 |
ggcttaattgcacttttggacccttatctttccaaaagttgcagttatgaacccct |
8774555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 12071958 - 12071903
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | | |||||||| |||||||||||||||| ||||||| |
|
|
| T |
12071958 |
ggcttaattgcacttttggatctctatctttccaaaagttgcggttatagacccct |
12071903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 13098032 - 13098079
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
13098032 |
gcttaattgcacttttggatccctatcttttaaaaagttgcggttatg |
13098079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 15912016 - 15911961
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| || ||| ||||| |
|
|
| T |
15912016 |
ggcttaattgcacttttgaccccctattttttcaaaagttgcgattttggccccct |
15911961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 207
Target Start/End: Original strand, 25820111 - 25820162
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
25820111 |
gcttaattgcacttttggacccctaactttccaaaagttgcggttacggacc |
25820162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 33811739 - 33811688
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
33811739 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggtgatgga |
33811688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 33871209 - 33871158
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
33871209 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggtgatgga |
33871158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 35580733 - 35580780
Alignment:
| Q |
150 |
atgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
35580733 |
atgaaggcttaattgcacttttggccccctatctttccaaaagttgcg |
35580780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 40814887 - 40814941
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
40814887 |
ggcttaattgcacttttggaccc-tatctttccaaaagttgcggttatggccccct |
40814941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 41585285 - 41585340
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| | | |||||||||||||||||||||||||||| |||| |
|
|
| T |
41585285 |
ggcttaattgcatttttggatctctatcttttcaaaagttgcggttatggatccct |
41585340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 42589420 - 42589475
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| || |||||||| |||||||||||||||||| ||||| |
|
|
| T |
42589420 |
ggcttaattgcacttttggacttctatctttacaaaagttgcggttatggccccct |
42589475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 43670627 - 43670572
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| |||| |||||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
43670627 |
ggcttaattgcacatttggacccctatatttccaaaagttgcggttatggccccct |
43670572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 7159507 - 7159549
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
7159507 |
ggcttaattgcacttttgaccccctatctttccaaaagttgcg |
7159549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 7764495 - 7764453
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7764495 |
aggcttaattgcacttttggccccctatcttttcaaaagttgc |
7764453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 8029269 - 8029215
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| | |||||||||| |||||||||| |||||||| |||| |
|
|
| T |
8029269 |
gcttaattgcacttttggatccctatctttccaaaagttgcagttatggatccct |
8029215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 30288511 - 30288457
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| | | ||||||||| |||||||||||||||| |||||| |
|
|
| T |
30288511 |
gcttaattgcacttttggatctctatcttttaaaaagttgcggttatgaacccct |
30288457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 30295184 - 30295130
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| |||||| ||||| |
|
|
| T |
30295184 |
aggcttaattgcacttttggacccctatctttctaaaagttgtggttatagaccc |
30295130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Original strand, 45664162 - 45664208
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||| ||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
45664162 |
ttaattgcatttttggacccctatctttttaaaagttgcggttatgg |
45664208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 46351537 - 46351495
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46351537 |
aggcttaattgcacttttggtcccctatcttttcaaaagttgc |
46351495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 18590143 - 18590094
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||| |||||||| |
|
|
| T |
18590143 |
ggcttaattgcacttttggatccctatctttttaaaagttgtggttatgg |
18590094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 19830116 - 19830169
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
19830116 |
cttaattgcacttttggacccttatctttcaaaaagttgcggctatggacccct |
19830169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 21727615 - 21727660
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
21727615 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatg |
21727660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 33811423 - 33811480
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| || |||||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
33811423 |
aaggcttaattacatttttgagcccctatctttctaaaagttgcggtcatggacccct |
33811480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 33870892 - 33870949
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| || |||||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
33870892 |
aaggcttaattacatttttgagcccctatctttctaaaagttgcggtcatggacccct |
33870949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 52201364 - 52201420
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
52201364 |
aaggcttaattgcacttttgg-cccctatcttttcaaaagttgcgattttggccccct |
52201420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 52363490 - 52363437
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
52363490 |
cttaattgcattttttgacccctatctttccaaaagttgcggttatgaacccct |
52363437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 202
Target Start/End: Original strand, 6912217 - 6912263
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
6912217 |
ggcttaattgcacttttgg-cccctatcttttcaaaagttgcgattat |
6912263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 21932101 - 21932046
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
21932101 |
ggcttaattgcactttttgccccctatcttttcaaaagttgcgattttggccccct |
21932046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 29153539 - 29153496
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
29153539 |
aggcttaatttcacttttggtcccctatcttttcaaaagttgcg |
29153496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 30289166 - 30289217
Alignment:
| Q |
153 |
aaggcttaattgcactttt-gaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||| ||||||| |
|
|
| T |
30289166 |
aaggcttaattgcacttttagaccccctatctttccaaaagttgtggttatg |
30289217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 204
Target Start/End: Complemental strand, 30289458 - 30289411
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||| ||||||||| |
|
|
| T |
30289458 |
cttaattgcacttttggacccatatctttccaaaagttacggttatgg |
30289411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 32037846 - 32037893
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||| ||||| |||||||| ||||||||||||| ||||||||| |
|
|
| T |
32037846 |
ttaattgcatttttggacccctattttttcaaaagttgtggttatgga |
32037893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 32038152 - 32038097
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| |||||| ||||||| |
|
|
| T |
32038152 |
ggcttaattgcacttttggatccctatctttctaaaagttgtggttatagacccct |
32038097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 35580983 - 35580940
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
35580983 |
aggcttaattgcacttttggccccctattttttcaaaagttgcg |
35580940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 12061586 - 12061628
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
12061586 |
ggcttaattgcacttttgaccctctatctttccaaaagttgcg |
12061628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Complemental strand, 46039195 - 46039153
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
46039195 |
ggcttaattgcacttttggccccctatctttttaaaagttgcg |
46039153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 21697187 - 21697147
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21697187 |
aggctcaattgcacttttga-cccctatcttttcaaaagttg |
21697147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 8535528 - 8535580
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||| |||||||||| |||||||| ||| |||||||| ||||||||||| |
|
|
| T |
8535528 |
ggcttaactgcacttttggacccctatttttctaaaagttgtggttatggacc |
8535580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 8600767 - 8600819
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||| |||||||||| |||||||| ||| |||||||| ||||||||||| |
|
|
| T |
8600767 |
ggcttaactgcacttttggacccctatttttctaaaagttgtggttatggacc |
8600819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 13099341 - 13099305
Alignment:
| Q |
168 |
ttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
13099341 |
ttttggactcctatcttttcaaaagttgcggttatgg |
13099305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 13344486 - 13344434
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| || ||| ||||| |
|
|
| T |
13344486 |
ttaattgcacttttggccccctattttttcaaaagttgcgattttggtcccct |
13344434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20288061 - 20288006
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||| || |||||||||| |||| |
|
|
| T |
20288061 |
aggcttaattgcacttttggacccatatctttccaaaa-ttacggttatggatccct |
20288006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Original strand, 30288226 - 30288262
Alignment:
| Q |
174 |
acccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
30288226 |
acccctatctttccagaagttgcggttatggacccct |
30288262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 194
Target Start/End: Original strand, 46038903 - 46038939
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46038903 |
ttaattgcacttttggccccctatcttttcaaaagtt |
46038939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 2e-23; HSPs: 177)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 994981 - 995048
Alignment:
| Q |
143 |
caattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
994981 |
caattaaataaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
995048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 41206452 - 41206390
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41206452 |
aaataaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggccccct |
41206390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 2321514 - 2321571
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2321514 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2321571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 5734182 - 5734239
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5734182 |
aaggcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
5734239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 17943356 - 17943413
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17943356 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
17943413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 23234095 - 23234038
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23234095 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23234038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 414969 - 414913
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414969 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
414913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 6014418 - 6014474
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6014418 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6014474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 37205539 - 37205595
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37205539 |
aggcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
37205595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 37953373 - 37953429
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37953373 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 45106434 - 45106490
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45106434 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45106490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 4133068 - 4133013
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4133068 |
ggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
4133013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 4167513 - 4167458
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4167513 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
4167458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 20820066 - 20820012
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20820066 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggaccc |
20820012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 7150840 - 7150897
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7150840 |
aaggcttaattgcatttttgaacccctatcttttcaaaagttgcagttatggacccct |
7150897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 20819750 - 20819807
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20819750 |
aaggcttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
20819807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 30359157 - 30359100
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30359157 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30359100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 37205856 - 37205799
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37205856 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37205799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 143 - 208
Target Start/End: Original strand, 37639495 - 37639560
Alignment:
| Q |
143 |
caattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||| ||||||| |
|
|
| T |
37639495 |
caattaaataaaggcttaattgcacttttggacccctatcttttcaaaagttgaggttttggaccc |
37639560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 37953688 - 37953631
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37953688 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 41625458 - 41625515
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41625458 |
aaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
41625515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 45209291 - 45209234
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45209291 |
aaggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
45209234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 1657699 - 1657643
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1657699 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1657643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 4146784 - 4146840
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4146784 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
4146840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 6335642 - 6335586
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6335642 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
6335586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 148 - 208
Target Start/End: Complemental strand, 8870581 - 8870521
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8870581 |
aaattaaggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggaccc |
8870521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 14032035 - 14032091
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14032035 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
14032091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 15187927 - 15187983
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15187927 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
15187983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 16531563 - 16531507
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16531563 |
aggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
16531507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 20095685 - 20095741
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20095685 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20095741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 20813735 - 20813791
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20813735 |
aggcttaattgcacttgtggacccctatcttttcaaaagttgcggttatggacccct |
20813791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 27339542 - 27339598
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27339542 |
aggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
27339598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 30845874 - 30845818
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30845874 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30845818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 42267455 - 42267511
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42267455 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
42267511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 42267772 - 42267716
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42267772 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42267716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 44886214 - 44886162
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44886214 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
44886162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 414667 - 414722
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
414667 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
414722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 5734498 - 5734443
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5734498 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5734443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 6641911 - 6641856
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6641911 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
6641856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 7151155 - 7151100
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7151155 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7151100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 8287919 - 8287864
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8287919 |
aaggcttagttgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8287864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 8870257 - 8870312
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
8870257 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
8870312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 39515558 - 39515613
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39515558 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39515613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 1657389 - 1657443
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1657389 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
1657443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 6107429 - 6107375
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6107429 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6107375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 6335333 - 6335387
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6335333 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
6335387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 14032345 - 14032291
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14032345 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
14032291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 38166477 - 38166539
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38166477 |
aaattaagacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 38593186 - 38593240
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
38593186 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
38593240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 995305 - 995252
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
995305 |
cttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
995252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 6745309 - 6745252
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| || ||||||| |
|
|
| T |
6745309 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggtaatagacccct |
6745252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 8834250 - 8834197
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8834250 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
8834197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 18530830 - 18530887
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
18530830 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcagctatggatccct |
18530887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 27822873 - 27822930
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
27822873 |
aaggcttaattgcacttttggacccctatctttccaaaatttgcggttatggacccct |
27822930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 31191785 - 31191728
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
31191785 |
aaggcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
31191728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 32332138 - 32332195
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
32332138 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
32332195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 38166797 - 38166744
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38166797 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 42906370 - 42906427
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
42906370 |
aaggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
42906427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 42906688 - 42906635
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
42906688 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
42906635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 45106750 - 45106693
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
45106750 |
aaggtttaattgcacttttgaacccctatctttttaaaagttgcggttatggatccct |
45106693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 1985879 - 1985827
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1985879 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1985827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 4107161 - 4107113
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4107161 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
4107113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 4132753 - 4132809
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| |
|
|
| T |
4132753 |
aggcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
4132809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 6014732 - 6014676
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6014732 |
aggcttaattgcacttttggatccctatctttttaaaagttgcggttatggacccct |
6014676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 6107116 - 6107172
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
6107116 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
6107172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 25249957 - 25250009
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25249957 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
25250009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29233819 - 29233763
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
29233819 |
aggcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
29233763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 33881397 - 33881345
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33881397 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
33881345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 36226729 - 36226673
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36226729 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
36226673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 39616865 - 39616809
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
39616865 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
39616809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 39625970 - 39626022
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39625970 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39626022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 39635520 - 39635572
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39635520 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39635572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 41015101 - 41015049
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41015101 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
41015049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 42642402 - 42642346
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
42642402 |
aggcttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
42642346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 44885907 - 44885959
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
44885907 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
44885959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 14024353 - 14024298
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14024353 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14024298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 18553284 - 18553229
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18553284 |
ggcttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
18553229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 20096000 - 20095945
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
20096000 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgggcccct |
20095945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 20283988 - 20283933
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
20283988 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
20283933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 20814054 - 20813999
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
20814054 |
ggcttaattgcacttttggacccctatctttccaaaacttgcggttatggacccct |
20813999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 21070616 - 21070561
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
21070616 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
21070561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 202
Target Start/End: Original strand, 23233781 - 23233828
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23233781 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
23233828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 28595933 - 28595980
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28595933 |
ttaattgcacttttgaacctctatcttttcaaaagttgcggttatgga |
28595980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 39626281 - 39626226
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
39626281 |
ggcttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39626226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 39635831 - 39635776
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
39635831 |
ggcttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39635776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 36801398 - 36801452
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
36801398 |
gcttaattgcacttttggacccctatctttccacaagttgcggttatggacccct |
36801452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 201
Target Start/End: Complemental strand, 42866406 - 42866360
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42866406 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggtta |
42866360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 1985567 - 1985624
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
1985567 |
aaggcttaattgtacttttggacctctatcttttcaatagttgcggttatggacccct |
1985624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 6641598 - 6641651
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6641598 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
6641651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 7013347 - 7013404
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7013347 |
aaggcttaattgcacttttagatccctatcttttcaaaagttgcggttttggacccct |
7013404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 7013665 - 7013608
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||||||||| ||||||| |
|
|
| T |
7013665 |
aaggcttaattgcacttttggatctctatcttttcaaaagttgcggttatagacccct |
7013608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 12330071 - 12330128
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
12330071 |
aaggtttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
12330128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 27339856 - 27339803
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27339856 |
ggcttaattgcatttttggacccctatctttttaaaagttgcggttatggaccc |
27339803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 30358843 - 30358896
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||||||||||||||||||||||| |
|
|
| T |
30358843 |
ggcttaattgcacttttggacctcgatcttttcaaaagttgcggttatggaccc |
30358896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 36788256 - 36788309
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
36788256 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatagacccct |
36788309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 37277458 - 37277515
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37277458 |
aaggcttaattgtacttttggacccctatttttttaaaagttgcggttatggacccct |
37277515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 39515869 - 39515812
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
39515869 |
aaggcttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
39515812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 41788653 - 41788706
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
41788653 |
cttaattgcacttttgaactcctatctttttaaaagttgcagttatggacccct |
41788706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 44807390 - 44807333
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
44807390 |
aaggcttaattgcacttttgaccccctatcttttcaaaagttgcgattttggccccct |
44807333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 4147094 - 4147042
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4147094 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
4147042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 6655279 - 6655331
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
6655279 |
ttaattgcacttttgaacccatatttttttaaaagttgcggttatggacccct |
6655331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 6735681 - 6735733
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
6735681 |
ttaattgcacttttgaacccatatttttttaaaagttgcggttatggacccct |
6735733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 14024195 - 14024247
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14024195 |
ttaattgcacgtttggacccctatctttacaaaagttgcggttatggacccct |
14024247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 37277770 - 37277718
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37277770 |
ttaattgcacttttggacccctatcttttcaaaagttatggttatggacccct |
37277718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 40918687 - 40918639
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
40918687 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
40918639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 42363882 - 42363830
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
42363882 |
ttaattgcacttttggacccctttctttttaaaagttgcggttatggacccct |
42363830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 45208979 - 45209031
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45208979 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
45209031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 45516234 - 45516178
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
45516234 |
aggcttaattgcatttttggactcctatcttttcaaaagttgcggttatgaacccct |
45516178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 2321830 - 2321775
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
2321830 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
2321775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 20056411 - 20056466
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| || |||||||||||||||||||| |
|
|
| T |
20056411 |
ggcttaattgcacttttggacccttatctttttaatagttgcggttatggacccct |
20056466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 20791018 - 20791065
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
20791018 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20791065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 30845554 - 30845609
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
30845554 |
ggcttaattgtacttttggacccctatctttccaaaagttgcggttatggatccct |
30845609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 31190643 - 31190698
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
31190643 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
31190698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 32318821 - 32318766
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
32318821 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatgaaccc |
32318766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 152 - 206
Target Start/End: Complemental strand, 33877813 - 33877758
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
33877813 |
gaaggcttaattgcacttttggaccccctatcttttcaaaagttgtggttatggac |
33877758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 35735504 - 35735558
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
35735504 |
ggcttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
35735558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 45480365 - 45480310
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| || ||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45480365 |
ggcttaactgtacttttggacccctatctttccaaaagttgcggttatggacccct |
45480310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 16531248 - 16531298
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
|||||||||| | ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16531248 |
ggcttaattgtatttttggacccctatcttttcaaaagttgcggttatgga |
16531298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 42525024 - 42524966
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
42525024 |
aaggtttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
42524966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 4167202 - 4167259
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
4167202 |
aaggcttaattgcacttttggacgcctattttttcaaaagttgtggttattgacccct |
4167259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 6655593 - 6655536
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6655593 |
aaggcttaattgcatttttggatccctatctttccaaaagttgcggtaatggacccct |
6655536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 6735995 - 6735938
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6735995 |
aaggcttaattgcatttttggatccctatctttccaaaagttgcggtaatggacccct |
6735938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 195
Target Start/End: Original strand, 7658601 - 7658642
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7658601 |
aggcttaattgcacttttgaccccctatcttttcaaaagttg |
7658642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 41206164 - 41206217
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
41206164 |
cttaattgcacttttggacccatatctttccaaaagttgcggttatggccccct |
41206217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 41554605 - 41554662
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
41554605 |
aaggcttaattgcactttcggacctttatcttttcaaaagttgcggttatggccccct |
41554662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 41574467 - 41574410
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
41574467 |
aaggtttaattgcacttttggacccctatctttctaaaagttgcgattatggacccct |
41574410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 42363580 - 42363633
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
42363580 |
cttaattgcacttttggacccttatctttccaaaagttgctgttatggacccct |
42363633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 42930928 - 42930883
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42930928 |
ttaattgcactttttgacccctatcttttcaaaagttgcggttatg |
42930883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 25250256 - 25250204
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||||||||||| ||||||| |
|
|
| T |
25250256 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatagacccct |
25250204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 27872709 - 27872765
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||||||||||||| |||| |
|
|
| T |
27872709 |
aggcttaattgcacttttggatccctatctttctaaaagttgcggttatggatccct |
27872765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 29233545 - 29233597
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29233545 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatgtacccct |
29233597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 31947853 - 31947909
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
31947853 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcgattttggccccct |
31947909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 33947043 - 33947099
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
33947043 |
aggcttaattgtacttttggacccctatctttccaaaagttgagattatggacccct |
33947099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 38593499 - 38593443
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| |||| ||| |||||||||||||||| ||||||| |
|
|
| T |
38593499 |
aggcttaattgcacttttggacctctatatttccaaaagttgcggttattgacccct |
38593443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 40918392 - 40918448
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
40918392 |
aggcttaatttcacttttggacccctatctttttaaaagttacggttatggccccct |
40918448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 41788960 - 41788905
Alignment:
| Q |
157 |
cttaattgcacttttgaacccc--tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
41788960 |
cttaattgcacttttggacccccctatcttttcaaaagttgcggttatggatccct |
41788905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 43658496 - 43658448
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
43658496 |
aaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
43658448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 8833942 - 8833993
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
8833942 |
ggcttaattgcacttttggacacctatctttcaaaaagttgcggttatggac |
8833993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 18531146 - 18531091
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
18531146 |
ggcttaattgcacttttggacccctatctttctaaaagttacggttatgaacccct |
18531091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 196
Target Start/End: Complemental strand, 18539330 - 18539287
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18539330 |
aaggcttaattgtacttttgatcccctatcttttcaaaagttgc |
18539287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 28596243 - 28596188
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| |||||||||||||| |
|
|
| T |
28596243 |
ggcttaattgcacttttggatccctatctttctaaaagttgtggttatggacccct |
28596188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 29197298 - 29197340
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29197298 |
aggcttaattgcacttttga-cccctatcttttcaaaagttgcg |
29197340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 32498377 - 32498420
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32498377 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcg |
32498420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 32693028 - 32692973
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
32693028 |
aggcttaattgtacttttggacccctatctttccaaaaattgcggttatggccccc |
32692973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 35409706 - 35409761
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||| |||| ||||||||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
35409706 |
aaataaaggtttaattgcacttttggatccctatctttccaaaagttgcggttatg |
35409761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 38701973 - 38701931
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38701973 |
aggcttaattgcacttttga-cccctatcttttcaaaagttgcg |
38701931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 41574155 - 41574210
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||| ||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
41574155 |
ggcttaattgtacttttggacctctattttttcaaaagttgtggttatggacccct |
41574210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 43657491 - 43657538
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
43657491 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
43657538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 202
Target Start/End: Original strand, 8287605 - 8287651
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
8287605 |
gcttaattgcacttttgaactcctatctttttaaaagttgcgattat |
8287651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 23623421 - 23623463
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23623421 |
ggcttaattgcacttttgaccccatatcttttcaaaagttgcg |
23623463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 29454344 - 29454395
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
29454344 |
aaggcttaattgcacttttggacccc--tctttccaaaagttgcggttatggac |
29454395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 33687801 - 33687759
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33687801 |
aggcttaattgcacttttgaccccttatcttttcaaaagttgc |
33687759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 210
Target Start/End: Original strand, 3411419 - 3411456
Alignment:
| Q |
173 |
aacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3411419 |
aacccctatctttccaaaagttgcggttatggacccct |
3411456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 20791312 - 20791263
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
20791312 |
aggcttaattgcatttttggacctctatctttccaaaagttgcggttatg |
20791263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 26920030 - 26919989
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26920030 |
aggcttaattgcacttttggccccctatcttttcaaaagttg |
26919989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 41693366 - 41693317
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| | || ||||||| ||||||||||||||||| |
|
|
| T |
41693366 |
aggcttaattgcacttttggatccttatctttccaaaagttgcggttatg |
41693317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 7653669 - 7653614
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| |||| || |||||||||||||||||| ||||| |
|
|
| T |
7653669 |
aggcttaattgcacttttggacccttatc-ttccaaaagttgcggttatggccccct |
7653614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 17075065 - 17075025
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
17075065 |
cttaattgcacttttgaccccctatctttttaaaagttgcg |
17075025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 17573205 - 17573245
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
17573205 |
cttaattgcacttttgaccccctatctttttaaaagttgcg |
17573245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 25910281 - 25910333
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | ||| | |||||||||||||||||||||||||||| |
|
|
| T |
25910281 |
ttaattgcacttttggagtcctttattttcaaaagttgcggttatggacccct |
25910333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 208
Target Start/End: Original strand, 32318495 - 32318559
Alignment:
| Q |
144 |
aattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||| |||||||||||| || ||||| || ||||||||| |||||||||||||||| |||| |
|
|
| T |
32318495 |
aattaaaagaaggcttaatttcatttttggactcctatctttctaaaagttgcggttatgaaccc |
32318559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 36788566 - 36788510
Alignment:
| Q |
155 |
ggcttaattgcacttttga-acccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| |||| | |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
36788566 |
ggcttaattgcattttttagacccttatctttttaaaagttgcggttatggacccct |
36788510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 41554901 - 41554845
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
41554901 |
aggcttaattgcacttttggatccctatctttctaaaagttgcggttgtggccccct |
41554845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 42524709 - 42524765
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||||| |||| ||||||| |
|
|
| T |
42524709 |
aggcttaattgcacttttggatccctatctttctaaaagttgcgattatagacccct |
42524765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 42642091 - 42642147
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42642091 |
aggcttaattgcacgttttgacccctatctttctaaaagttggggttatggacccct |
42642147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 42866151 - 42866206
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||||||||||||| |||||||| |
|
|
| T |
42866151 |
aggcttaattgcacttttagatctctatcttttcaaaagttgcggtta-ggacccct |
42866206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 201
Target Start/End: Complemental strand, 3345684 - 3345641
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
3345684 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
3345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 193
Target Start/End: Complemental strand, 7318948 - 7318910
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagt |
193 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
7318948 |
ggcttaattgcacttttggacccctatctttccaaaagt |
7318910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 17943654 - 17943604
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||| ||||||||||| | |||||||||||| |||||||| |||||||| |
|
|
| T |
17943654 |
aaggctaaattgcactttaggacccctatctttccaaaagttacggttatg |
17943604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 201
Target Start/End: Original strand, 3340071 - 3340112
Alignment:
| Q |
160 |
aattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
3340071 |
aattgcacttttggacccctaactttccaaaagttgcggtta |
3340112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 204
Target Start/End: Original strand, 4106870 - 4106918
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
4106870 |
gcttaatttcacttttggacccctatcttttcaaacattgcgggtatgg |
4106918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 8038376 - 8038332
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||| ||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
8038376 |
aaggcttgattgcacttttgacctcatatcttttcaaaagttgcg |
8038332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 27300831 - 27300791
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
27300831 |
ggcttaattgcacttttgatcctctatctttttaaaagttg |
27300791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 27873023 - 27872971
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||| ||||||||| |
|
|
| T |
27873023 |
aggcttaattgctcttttggatccctatctttctaaaagttgcagttatggac |
27872971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 34608692 - 34608637
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||||| || ||| ||||| |
|
|
| T |
34608692 |
aggcttaattgcacttttg-acccatatctttttaaaagttgcgattttggccccct |
34608637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 36623903 - 36623946
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
36623903 |
aaggcttaattgcacttttg-actcctatctcttcaaaagttgcg |
36623946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 36624225 - 36624182
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
36624225 |
aaggcttaattgcatttttgg-cccctatcttttcaaaagttgcg |
36624182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 179)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 143 - 210
Target Start/End: Complemental strand, 2710662 - 2710595
Alignment:
| Q |
143 |
caattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2710662 |
caattaaaataaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2710595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 40687659 - 40687721
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40687659 |
aaattaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40687721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 7623835 - 7623778
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7623835 |
aaggtttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
7623778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 16597355 - 16597302
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16597355 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
16597302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 23263143 - 23263200
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23263143 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23263200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 34606685 - 34606628
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34606685 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34606628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 35307017 - 35306960
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35307017 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35306960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 3020908 - 3020852
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3020908 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3020852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 34734387 - 34734331
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34734387 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34734331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 8339959 - 8340014
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8339959 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8340014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 26323688 - 26323633
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26323688 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26323633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 34169101 - 34169046
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34169101 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34169046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 39528766 - 39528821
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39528766 |
ggcttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
39528821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 16521147 - 16521209
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16521147 |
aaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16521209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 40297658 - 40297720
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40297658 |
aaatgtaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40297720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 2546687 - 2546630
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2546687 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcagttatggatccct |
2546630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 2710338 - 2710395
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2710338 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2710395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 4125442 - 4125499
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4125442 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4125499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 5088387 - 5088330
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5088387 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5088330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 10029387 - 10029330
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10029387 |
aaggcttaattgcacttttgaacccctatctttcgaaaagttgcggttatggacccct |
10029330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 14647694 - 14647751
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14647694 |
aaggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
14647751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 15738388 - 15738331
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15738388 |
aaggcttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
15738331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 26151792 - 26151849
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26151792 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26151849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 28736755 - 28736698
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28736755 |
aaggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
28736698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 34082422 - 34082361
Alignment:
| Q |
147 |
taaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
34082422 |
taaataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgcaccc |
34082361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 40767890 - 40767943
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40767890 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40767943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 40768203 - 40768146
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40768203 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40768146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 42739525 - 42739582
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42739525 |
aaggcttaattgtacttttgaacccctatcttttcaaaagttgtggttatggacccct |
42739582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 3020593 - 3020649
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3020593 |
aggcttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
3020649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 13765258 - 13765314
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13765258 |
aggcttaattgcacttttcgacccctatcttttcaaaagttgcggttatggacccct |
13765314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 15526703 - 15526759
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15526703 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15526759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 16666072 - 16666128
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16666072 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
16666128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 25631085 - 25631141
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25631085 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
25631141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 27264108 - 27264164
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27264108 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 28394932 - 28394988
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28394932 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28394988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29401403 - 29401347
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29401403 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29401347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 31456175 - 31456119
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31456175 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
31456119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 40687983 - 40687927
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40687983 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
40687927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 223207 - 223152
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
223207 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
223152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 28620027 - 28620094
Alignment:
| Q |
143 |
caattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||| |||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28620027 |
caataaaattaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28620094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 31455882 - 31455937
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31455882 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
31455937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 3223604 - 3223542
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
3223604 |
aaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
3223542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 7219497 - 7219551
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
7219497 |
aggcttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
7219551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 206
Target Start/End: Complemental strand, 16666893 - 16666835
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
16666893 |
aaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16666835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 22773897 - 22773843
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22773897 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
22773843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 30894124 - 30894178
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
30894124 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
30894178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 31172876 - 31172822
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31172876 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
31172822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 41880349 - 41880295
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41880349 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41880295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 1055374 - 1055423
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1055374 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
1055423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 12049117 - 12049174
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12049117 |
aaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
12049174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 16597039 - 16597096
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16597039 |
aaggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
16597096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 20974462 - 20974515
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20974462 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20974515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 28395244 - 28395191
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28395244 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28395191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 4125758 - 4125702
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
4125758 |
aggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
4125702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 5088073 - 5088129
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
5088073 |
aggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
5088129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 8340275 - 8340219
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8340275 |
aaggcttaattccacttttggacccctatcttttcaaaagttgcgcttatggacccc |
8340219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 8755016 - 8755068
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8755016 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
8755068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 11480035 - 11480091
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11480035 |
aggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
11480091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 13356556 - 13356612
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13356556 |
aggcttgattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13356612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 18266351 - 18266407
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
18266351 |
aggcttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
18266407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20974723 - 20974667
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20974723 |
aggcttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
20974667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 22052438 - 22052494
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22052438 |
aggcttaattgcacttttggccccctatctttccaaaagttgcggttatggacccct |
22052494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 22052753 - 22052697
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22052753 |
aggcttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
22052697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 23103922 - 23103978
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23103922 |
aggcttaattacacttttggacccctatctttccaaaagttgcggttatggacccct |
23103978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 27264415 - 27264363
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27264415 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 29183136 - 29183188
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29183136 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29183188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 34082102 - 34082154
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34082102 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
34082154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 35306709 - 35306765
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
35306709 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
35306765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 43586100 - 43586044
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
43586100 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
43586044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 14648001 - 14647946
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14648001 |
ggcttaattgtacttttggacccctatcttttcaaaagtcgcggttatggacccct |
14647946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 15738074 - 15738129
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15738074 |
ggcttaattgcactttttgacccctatcttttcaaaagttgcggttatggatccct |
15738129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 22925698 - 22925753
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
22925698 |
aggcttaattgcacttttgaacctctatctttccaaaagttgcggttatagacccc |
22925753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 25566852 - 25566801
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25566852 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
25566801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 29401092 - 29401143
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29401092 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
29401143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 42739900 - 42739845
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
42739900 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatgaacccct |
42739845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 931846 - 931900
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
931846 |
aggcttaattgtacttttggatccctatcttttcaaaagttgcggttatggaccc |
931900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 4096766 - 4096712
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
4096766 |
aaggcttaattgcacttttggacctttatcttttcaaaagttgcggttatggacc |
4096712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 9071967 - 9072016
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
9071967 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
9072016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 9072264 - 9072207
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
9072264 |
aaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggccccct |
9072207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 13170195 - 13170138
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
13170195 |
aaggcttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
13170138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 13765576 - 13765519
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
13765576 |
aaggcttaattgcacttttggacccctatctttcaaaaaattgcggttatggacccct |
13765519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 13961004 - 13960951
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
13961004 |
aggcttaattgtacttttggacctctatcttttcaaaagttgcggttatggacc |
13960951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 16079493 - 16079436
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16079493 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggccccct |
16079436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 16329890 - 16329837
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
16329890 |
cttaattgcacttttggatccctatcttttcaaaagttgtggttatggacccct |
16329837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 23104222 - 23104165
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatctttt-caaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
23104222 |
aggcttaattgcacttttggacccttatcttttccaaaagttgcggttatggacccct |
23104165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 26036531 - 26036474
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
26036531 |
aaggctaaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
26036474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 28251400 - 28251453
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
28251400 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
28251453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 29559772 - 29559825
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
29559772 |
aaggcttaattgcacttttggattcctatcttttcaaaagttgcggttatggac |
29559825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 30894431 - 30894374
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30894431 |
aaggcttaattgcatttttggatccctatcttttcaaaagttgtggttatggacccct |
30894374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 41140429 - 41140372
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
41140429 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
41140372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 1050041 - 1050089
Alignment:
| Q |
160 |
aattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
1050041 |
aattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
1050089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 1055682 - 1055626
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
1055682 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
1055626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 3223435 - 3223491
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |||||||||||| ||||| |
|
|
| T |
3223435 |
aggcttaattgcacttttggacccctatctattcaaaaattgcggttatggccccct |
3223491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 7219811 - 7219755
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| || | ||||||| |||||||||||||||||||||||| |
|
|
| T |
7219811 |
aggcttaattgcacttttggactcttatctttccaaaagttgcggttatggacccct |
7219755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 8755323 - 8755271
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
8755323 |
ttaattgcacttttggacccctattttttcaaaagttgtggttatggacccct |
8755271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 12049431 - 12049375
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
12049431 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatagacccct |
12049375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 13356863 - 13356807
Alignment:
| Q |
155 |
ggcttaattgcacttttgaa-cccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13356863 |
ggcttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
13356807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 13960691 - 13960743
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13960691 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
13960743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 19849555 - 19849607
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19849555 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
19849607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 19849857 - 19849801
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
19849857 |
aggcttaattgcacttttggacccctatatttccaaaagttgcggtcatggacccct |
19849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 22627297 - 22627241
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| |||||||| ||||||||| |
|
|
| T |
22627297 |
aggcttaattgcacttttggatccctatcttttcaaaatttgcggttctggacccct |
22627241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 28736443 - 28736495
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
28736443 |
ttaattgcacttttggacccctatttttccaaaagttgcggttatggacccct |
28736495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 33825603 - 33825655
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33825603 |
ttaattgcacgtttggacccctatctttccaaaagttgcggttatggacccct |
33825655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 35055776 - 35055832
Alignment:
| Q |
155 |
ggcttaattgcacttttgaa-cccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35055776 |
ggcttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
35055832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 153 - 205
Target Start/End: Complemental strand, 39529080 - 39529028
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
39529080 |
aaggcttaattacacttttggacccctatctttccaaaagttgcggttatgga |
39529028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 40297976 - 40297924
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | |||||||||| |||||||||||||||||||||||| |
|
|
| T |
40297976 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
40297924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 42779166 - 42779222
Alignment:
| Q |
155 |
ggcttaattgcacttttgaa-cccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42779166 |
ggcttaattgcacttttggagcccctatctttttaaaagttgcggttatggacccct |
42779222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 8986610 - 8986665
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8986610 |
ggcttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
8986665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 10331955 - 10331998
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10331955 |
aggcttaattgcacttttgaccccctatcttttcaaaagttgcg |
10331998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 152 - 207
Target Start/End: Original strand, 21583320 - 21583375
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
21583320 |
gaaggcttaattgcactttgggacctctatctttccaaaagttgcggttatggacc |
21583375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 21583636 - 21583585
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||||||||||||||| |
|
|
| T |
21583636 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
21583585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 23263458 - 23263403
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
23263458 |
ggcttaattgcacttttggacctctatctttccaacagttgcggttatggacccct |
23263403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 23499971 - 23500014
Alignment:
| Q |
160 |
aattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23499971 |
aattgcacttttggacccctatcttttcaaaagttgcggttatg |
23500014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 23502441 - 23502386
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
23502441 |
ggcttaattgcacttttggacccctatctttccaaaagttgctattatggacccct |
23502386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 32555764 - 32555819
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
32555764 |
ggcttaattgcatttttggacccctatctttttaaaagttgcggttatggccccct |
32555819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 37887671 - 37887714
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37887671 |
aggcttaattgcacttttgaccccctatcttttcaaaagttgcg |
37887714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 204
Target Start/End: Complemental strand, 41032501 - 41032450
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
41032501 |
aaggcttaattgcacttttggatccctatctttccaaaagttgcggttatgg |
41032450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 2546372 - 2546426
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
2546372 |
gcttaattgcacttttggacccctatctttccaaaagttacggttatgaacccct |
2546426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 5891790 - 5891744
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
5891790 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
5891744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 8986925 - 8986868
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgc-ggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8986925 |
aaggcttaattgcacttttggacccctatcttttc-aaagttgcgggttatggacccct |
8986868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 142 - 196
Target Start/End: Complemental strand, 17235331 - 17235277
Alignment:
| Q |
142 |
acaattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17235331 |
acaattaaatttaggcttaattgcacttttggtcccctatcttttcaaaagttgc |
17235277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 21347742 - 21347696
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
21347742 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatgg |
21347696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 26036234 - 26036284
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||| |||||||| |
|
|
| T |
26036234 |
aggcttaattgcacttttggacccatatcttttcaaaagttgtggttatgg |
26036284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 32556059 - 32556009
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
32556059 |
aggcttaattgcacttttggacccatatctttccaaaagttgcggttatgg |
32556009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 34168790 - 34168840
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
34168790 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggaccc |
34168840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 200
Target Start/End: Original strand, 34606372 - 34606418
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggtt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
34606372 |
aggcttaattgcacttttaaacccctatctttccaaaagttgcggtt |
34606418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 42947399 - 42947453
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| |||||||||||||||||||| |
|
|
| T |
42947399 |
aaggcttaattgcacttttggactcctatctttctaaaagttgcggttatggacc |
42947453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 3738391 - 3738440
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
3738391 |
ttaattgcacttttggactcctattttttcaaaagttgcggttatggacc |
3738440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 16859956 - 16860013
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
16859956 |
aaggtttaattgcacttttggacccctatctttttaaaagttgtggttatggccccct |
16860013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 20465501 - 20465558
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
20465501 |
aaggcttaattacacttttggacccctatctttccaaaagttgcagttatggccccct |
20465558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 22773582 - 22773635
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| | |||||||||| |
|
|
| T |
22773582 |
aggcttaattgcacttttgaattcctatcttttcaaaagttacagttatggacc |
22773635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 23695524 - 23695581
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||| | |||||||||||||||||||||| |
|
|
| T |
23695524 |
aaggcttaattgcacttttggacccatatttttcccaaagttgcggttatggacccct |
23695581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 28251693 - 28251644
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
28251693 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttat |
28251644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 28703962 - 28703913
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
28703962 |
ggctgaattgcacttttggacccctatctttccaaaagttgcggttatgg |
28703913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 33203941 - 33203990
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
33203941 |
ttaattgcaattttggacccctatcttttcaaaagttgcggttatagacc |
33203990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 43585803 - 43585860
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
43585803 |
aaggcataattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
43585860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 38992 - 39044
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | || |||||||||||||||||||||||||| ||||| |
|
|
| T |
38992 |
ttaattgcacttttggatccatatcttttcaaaagttgcggttatggtcccct |
39044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 39282 - 39234
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
39282 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcagttatg |
39234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 3728283 - 3728339
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
3728283 |
aggcttaattgtacttttggacctctatctttccaaaagttgcggttatggtcccct |
3728339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 4096455 - 4096507
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
4096455 |
ttaattgcacttttggacccctatctttctaaaagttgcgtttatggacccct |
4096507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 7623525 - 7623576
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
7623525 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
7623576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 26152106 - 26152050
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| |||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
26152106 |
aggcttaattgtacttttagacccatatctttccaaaagttgcggttatggacccct |
26152050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 29560091 - 29560035
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
|||||||||||||| || || ||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
29560091 |
aaggcttaattgcatttatggacccctatctttttaaaagttgcggttatagacccc |
29560035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 35678095 - 35678147
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35678095 |
ttaattgcatttttggacccctatctttccaaaagttgcgattatggacccct |
35678147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 6815500 - 6815542
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6815500 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcg |
6815542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 10029072 - 10029126
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||| | ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10029072 |
aaggcttaattacttttttggacccctatctttccaaaagttgcggttatggacc |
10029126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 16860118 - 16860064
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
16860118 |
gcttaattgcacttttggacccctatttttctaaaagttgcggttatggtcccct |
16860064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 3738551 - 3738494
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||| | ||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
3738551 |
aaggattaattgtatttttggacctctatctttttaaaagttgcggttatggacccct |
3738494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 9560148 - 9560099
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||| |
|
|
| T |
9560148 |
aggcttaattgcatttttggacccctatctttctaaaagttgcggttatg |
9560099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 26323377 - 26323430
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||| | |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26323377 |
cttatttgcactttgggacccctatctttccaaaagttggggttatggacccct |
26323430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 29391328 - 29391275
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||| || | ||||||| ||||||||||||||||||||| |
|
|
| T |
29391328 |
aggcttaattgcacttttagactcttatctttccaaaagttgcggttatggacc |
29391275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 37333848 - 37333791
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| ||||||||||||| ||| ||||| |
|
|
| T |
37333848 |
aaggcttaattgcacttttggacccttatctttctaaaagttgcggttttggtcccct |
37333791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 4146110 - 4146162
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
4146110 |
ttaattgcatttttggccccctatcttttcaaaagttgcgattttggacccct |
4146162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 9559859 - 9559903
Alignment:
| Q |
160 |
aattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
9559859 |
aattgcacttttggatctctatcttttcaaaagttgcggttatgg |
9559903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 12610242 - 12610286
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
12610242 |
aaggcttaattgcacttttggccccctatctttttaaaagttgcg |
12610286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 210
Target Start/End: Original strand, 16329604 - 16329636
Alignment:
| Q |
178 |
ctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16329604 |
ctatcttttcaaaagttgcggttatggacccct |
16329636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 17235134 - 17235178
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
17235134 |
aaggcttaattgtacttttggccccctatcttttcaaaagttgcg |
17235178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 22925947 - 22925899
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||| | |||||| ||||||||||||| |||||||||| |
|
|
| T |
22925947 |
ttaattgcacttttggatccctattttttcaaaagttgtggttatggac |
22925899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 15526984 - 15526929
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||| | ||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
15526984 |
aaggcttaattggatttttggacctatatctttccaaaagttgcggttatggaccc |
15526929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 31172567 - 31172619
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
31172567 |
aggcttaattgcacttttggacccctatct----aaaagttgcgattatggacccct |
31172619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 37060211 - 37060156
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||| || ||||||||| |
|
|
| T |
37060211 |
ggcttaattgcacttttggccccctatctttccaaaagttgcaattttggacccct |
37060156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 3728576 - 3728522
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| | | |||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3728576 |
gcttaattgcacttttggatctctatctttccaaaagttacggttatggccccct |
3728522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 25693901 - 25693943
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
25693901 |
ggcttaattgtacttttggccccctatcttttcaaaagttgcg |
25693943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 33204258 - 33204197
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||| ||||||||||||||| | || ||| |||||||||||| ||||||||||||||| |
|
|
| T |
33204258 |
aaattaaggtttaattgcacttttggatcc-tattttttcaaaagttacggttatggacccct |
33204197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 35678394 - 35678344
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||| ||||| || || ||||||| |||||||||||||||||||| |
|
|
| T |
35678394 |
cttaattgcaattttggactcccatctttttaaaagttgcggttatggacc |
35678344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 194
Target Start/End: Complemental strand, 6815744 - 6815703
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
6815744 |
aaggcttaattgcacttttggccctctatcttttcaaaagtt |
6815703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 10169013 - 10169070
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
10169013 |
aaggtttaattgcacttttggccccctatctttttaaaagttgcgattttggtcccct |
10169070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 24396121 - 24396064
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatc-ttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||| |||||||| |||||||| ||||| |
|
|
| T |
24396121 |
aggcttaattgcacttttggacctctatcttttttaaaagttgtggttatggtcccct |
24396064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 25631396 - 25631339
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| | | |||| ||| ||||||||||||||||||||||| |
|
|
| T |
25631396 |
aaggtttaattgcacttttggatctctatttttctaaaagttgcggttatggacccct |
25631339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 28388295 - 28388238
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| | ||| |||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
28388295 |
aaggcttaattgcgcaattggacccctatctttccaaaaattgaggttatggacccct |
28388238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 197
Target Start/End: Complemental strand, 39573838 - 39573797
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
39573838 |
gcttaattgcacttttggtcccctatctttttaaaagttgcg |
39573797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 4146451 - 4146411
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
4146451 |
ggcttaattgcacttttggccccctatctttccaaaagttg |
4146411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 12610587 - 12610547
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
12610587 |
ggcttaattgcacttttggccctctatcttttcaaaagttg |
12610547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Complemental strand, 15221529 - 15221489
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagt |
193 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
15221529 |
aaggcttaattgcacttttggacccatatctttccaaaagt |
15221489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 20041021 - 20040982
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20041021 |
cttaattgcacttttgg-cccctatcttttcaaaagttgcg |
20040982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 22626988 - 22627040
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| |||||||| ||||||||| |||| |||||||| |
|
|
| T |
22626988 |
ttaattgcacttttggacctctatctttccaaaagttgtagttaaggacccct |
22627040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 210
Target Start/End: Original strand, 28387984 - 28388036
Alignment:
| Q |
159 |
taattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
28387984 |
taattgcacttttggaccccctatctttccaaaagttgcgtgtatggacccct |
28388036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 33749249 - 33749285
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagt |
193 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33749249 |
cttaattgcacttttggccccctatcttttcaaaagt |
33749285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 42779478 - 42779426
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| ||||||||| ||| |||||||| ||||| ||| |||||||||||||| |
|
|
| T |
42779478 |
ttaatcgcacttttggacctctatctttccaaaaattgtggttatggacccct |
42779426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 54; Significance: 3e-22; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 79310 - 79245
Alignment:
| Q |
145 |
attaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
79310 |
attaaatttaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
79245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 12973 - 12916
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
12973 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggatccct |
12916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 204
Target Start/End: Original strand, 78988 - 79039
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
78988 |
aaggcttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
79039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 3e-22; HSPs: 187)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 3925791 - 3925848
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3925791 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3925848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 18852493 - 18852550
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18852493 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18852550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 23909893 - 23909950
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23909893 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23909950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 34533528 - 34533471
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533528 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34533471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 931022 - 930966
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
931022 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
930966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 21917564 - 21917508
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21917564 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21917508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 25986924 - 25986980
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25986924 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25986980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35121727 - 35121671
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35121727 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35121671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 37452363 - 37452307
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37452363 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37452307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 26612656 - 26612601
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26612656 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26612601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 34288364 - 34288309
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34288364 |
ggcttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
34288309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 38445719 - 38445664
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38445719 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38445664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 3235436 - 3235374
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3235436 |
aaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3235374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 35437534 - 35437472
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35437534 |
aaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35437472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 4060990 - 4061043
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4060990 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatgaacccct |
4061043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 7974387 - 7974444
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
7974387 |
aaggcttaattgcacttttgaacccctatttttccaaaagttgcggttatggacccct |
7974444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 10319206 - 10319153
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10319206 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
10319153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 11900048 - 11900105
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11900048 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 11900365 - 11900308
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11900365 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 21782601 - 21782658
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21782601 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
21782658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 27432488 - 27432545
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27432488 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27432545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 27512800 - 27512857
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27512800 |
aaggcttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
27512857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 36376058 - 36376115
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36376058 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36376115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 37047977 - 37047924
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37047977 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37047924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 46622552 - 46622609
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46622552 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
46622609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 5096787 - 5096843
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5096787 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5096843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 7974705 - 7974649
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7974705 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7974649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 16879234 - 16879290
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16879234 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
16879290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 210
Target Start/End: Complemental strand, 19194483 - 19194419
Alignment:
| Q |
146 |
ttaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
19194483 |
ttaaataaaggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
19194419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 25982988 - 25983044
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25982988 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25983044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 30699337 - 30699285
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30699337 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
30699285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 30757223 - 30757279
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30757223 |
aggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
30757279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 35121412 - 35121468
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35121412 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
35121468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 35711968 - 35711916
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35711968 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35711916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 37996016 - 37996072
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37996016 |
aggcttaattgcacttttggacccctatcttttcaaacgttgcggttatggacccct |
37996072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 39753871 - 39753927
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39753871 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39753927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 42997055 - 42997111
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42997055 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42997111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 388214 - 388159
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
388214 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
388159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 930708 - 930763
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
930708 |
ggcttaattacacttttggacccctatcttttcaaaagttgcggttatggacccct |
930763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 16537077 - 16537132
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
16537077 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16537132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 16628585 - 16628530
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
16628585 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16628530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 23740262 - 23740317
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23740262 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
23740317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 23910168 - 23910113
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23910168 |
ggcttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
23910113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 27513116 - 27513061
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
27513116 |
aaggcttaattgcacttttggacccctatcttttcgaaagttgcggttatggaccc |
27513061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 38053461 - 38053406
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
38053461 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
38053406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 204
Target Start/End: Complemental strand, 43408519 - 43408468
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43408519 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
43408468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 5097097 - 5097043
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5097097 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
5097043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 38882689 - 38882631
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatctttt-caaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38882689 |
aaggcttaattgcacttttggacccctatcttttccaaaagttgcggttatggacccct |
38882631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 228273 - 228216
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
228273 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttttggacccct |
228216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 497110 - 497167
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
497110 |
aaggcttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
497167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 10312542 - 10312485
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
10312542 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10312485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 10318889 - 10318946
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
10318889 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcagttatgaacccct |
10318946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 10350804 - 10350861
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10350804 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
10350861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 16879553 - 16879500
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
16879553 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16879500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 17757768 - 17757825
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17757768 |
aaggcttaattgcacttttagacccctatctttttaaaagttgcggttatggacccct |
17757825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 18296170 - 18296109
Alignment:
| Q |
149 |
aatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18296170 |
aatgtaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
18296109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 18363609 - 18363552
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
18363609 |
aaggcttaattgcacttttggacccctatctttgcaaaagttgcggttatggatccct |
18363552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 19194158 - 19194215
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
19194158 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatagacccct |
19194215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 19778568 - 19778519
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19778568 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
19778519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 20387865 - 20387808
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
20387865 |
aaggcttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20387808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 20392339 - 20392282
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
20392339 |
aaggcttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20392282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 21917084 - 21917141
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
21917084 |
aaggcttaattgcacttttggatccctattttttcaaaagttgcggttatggacccct |
21917141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 25987238 - 25987181
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25987238 |
aaggattaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25987181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 26612340 - 26612397
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26612340 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
26612397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 32555616 - 32555559
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32555616 |
aaggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
32555559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 34288046 - 34288103
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34288046 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
34288103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 34404750 - 34404693
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
34404750 |
aaggcttaagtgcacttttgaacccttatctttccaaaagttgcggttatggacccct |
34404693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 35711657 - 35711713
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35711657 |
aaggcttaattgcacttttggacccctatcttttc-aaagttgcggttatggacccct |
35711713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 35923894 - 35923947
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35923894 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35923947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 35924206 - 35924149
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35924206 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
35924149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 47731700 - 47731757
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
47731700 |
aaggcttaattgcacttttggacccctatcttttaaaaaattgcggttatggacccct |
47731757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 9629330 - 9629274
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9629330 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
9629274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 18295855 - 18295907
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18295855 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
18295907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 18852807 - 18852751
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18852807 |
aggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
18852751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 30140919 - 30140975
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30140919 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
30140975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 30141234 - 30141178
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
30141234 |
aggcttaattgcacttttggacccctatctttgcaaaagttgcggttatagacccct |
30141178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 35437205 - 35437261
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35437205 |
aggcttaattgcacatttggacccctatctttccaaaagttgcggttatggacccct |
35437261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 37047668 - 37047720
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37047668 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
37047720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 38879160 - 38879216
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38879160 |
aggcttaattgtacttttggacctctatcttttcaaaagttgcggttatggacccct |
38879216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 38882369 - 38882425
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38882369 |
aggcttaattgcatttttgtacccctatcttttcaaaagttgcggttatgaacccct |
38882425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 39976729 - 39976781
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
39976729 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
39976781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 44214658 - 44214714
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44214658 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
44214714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 46622867 - 46622811
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
46622867 |
aggcttaattgcacttttcaacccctatctttccaaaggttgcggttatggacccct |
46622811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 3926071 - 3926016
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
3926071 |
ggcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
3926016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 4061301 - 4061246
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4061301 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
4061246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 10351119 - 10351064
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
10351119 |
ggcttaattgcacttttggaccccaatcttttcaaaagttacggttatggacccct |
10351064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 18073816 - 18073871
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18073816 |
ggcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
18073871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 145 - 204
Target Start/End: Original strand, 44189395 - 44189454
Alignment:
| Q |
145 |
attaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||| ||| ||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
44189395 |
attaaaagaatgcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
44189454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 45231522 - 45231577
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
45231522 |
ggcttaattgcacttttggacccctatcttttcaaaagttacggttatggatccct |
45231577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 47732014 - 47731963
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
47732014 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatggaccc |
47731963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 9035356 - 9035410
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
9035356 |
aaggcttaattgcaattttggacccctatctttttaaaagttgcggttatggacc |
9035410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 204
Target Start/End: Original strand, 19778277 - 19778323
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19778277 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
19778323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 25983311 - 25983249
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
25983311 |
aaataaaggcttaattgcacttttgggcctctatctttttaaaagttgcggttatggacccct |
25983249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 30699016 - 30699078
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||||||| |||||||||| ||||||||||||| |
|
|
| T |
30699016 |
aaattaaggcttaattgcacttttggatccctatctttccaaaagttgcagttatggacccct |
30699078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 48871403 - 48871349
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
48871403 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
48871349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 18074130 - 18074073
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
18074130 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggatccct |
18074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 19233632 - 19233583
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
19233632 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
19233583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 30401223 - 30401166
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
30401223 |
aaggcttaattgcacttttggactcctatcttttcaaaagttgtggttatggccccct |
30401166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 34533212 - 34533269
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
34533212 |
aaggcttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
34533269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 36376377 - 36376320
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
36376377 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggaaccct |
36376320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 227960 - 228012
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
227960 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
228012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 18363294 - 18363350
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
18363294 |
aggcttaattgcacttttggacccctatgtttccaaaagttgcgattatggacccct |
18363350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 19233339 - 19233395
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
19233339 |
aggcttaattgcacttttggaaccctatctttccaaaagttgcggttatggccccct |
19233395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 23740579 - 23740523
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23740579 |
aggcttaattgtacttttggacccctatctttcgaaaagttgcggttatggacccct |
23740523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 30757534 - 30757482
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30757534 |
ttaattgcacttttggacccctatttttttaaaagttgcggttatggacccct |
30757482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 38879464 - 38879408
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
38879464 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggctatggatccct |
38879408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 144 - 204
Target Start/End: Original strand, 43632330 - 43632390
Alignment:
| Q |
144 |
aattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||| || |||||||||||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
43632330 |
aattacataaaggcttaattgcacttttggacccctatctttccaaaaattgcggttatgg |
43632390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 45231830 - 45231778
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
45231830 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45231778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 11275478 - 11275423
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11275478 |
ggcttaattacacctttggacccctatcttttcaaaagttgcggttatggccccct |
11275423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 24775938 - 24775883
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||| | ||||||||| |||||||||||||| |
|
|
| T |
24775938 |
ggcttaattgcacttttggacccctatctctccaaaagttgtggttatggacccct |
24775883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 34404443 - 34404498
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
34404443 |
ggcttaattgcacttttagacccctatctttccaaaaattgcggttatggacccct |
34404498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 42997365 - 42997318
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42997365 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
42997318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 204
Target Start/End: Complemental strand, 44189699 - 44189648
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
44189699 |
aaggtttaattgcacttctggacccctatcttttcaaaagttgcggttatgg |
44189648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 10356412 - 10356362
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
10356412 |
aggcttaattgcacttttggacccctatatttccaaaagttgcggttatgg |
10356362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 25036033 - 25036087
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
25036033 |
gcttaattgcactttttgacccctatattttcaaaagttgcggttatggatccct |
25036087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 40436034 - 40436084
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
40436034 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
40436084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 5181746 - 5181689
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
5181746 |
aaggtttaattgcacttttagacccctatcttttcaaaaattgcagttatggacccct |
5181689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 9035673 - 9035620
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||||||||||||||||||| |
|
|
| T |
9035673 |
cttaattgcacttttggattcctatctttccaaaagttgcggttatggacccct |
9035620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 20387555 - 20387608
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
20387555 |
cttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20387608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 20392029 - 20392082
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
20392029 |
cttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20392082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 24236423 - 24236366
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
24236423 |
aaggcttaattgcatttttgcacccgtatctttctaaaagttgcggttatggacccct |
24236366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 37452049 - 37452106
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | || ||||||||||||||||||||||||||| |||| |
|
|
| T |
37452049 |
aaggcttaattgcacttttagatccatatcttttcaaaagttgcggttatggatccct |
37452106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 3931646 - 3931694
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
3931646 |
ggcttaattgcacttttggacctctatcttttcaaaagttggggttatg |
3931694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 7195459 - 7195511
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
7195459 |
ttaattgcatttttggacccctatcttttcaaaagttgcagttatggatccct |
7195511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 9629011 - 9629067
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||| || |||||||||| |||||||||||||||||| |||| |
|
|
| T |
9629011 |
aggcttaattacacttttggactcctatctttttaaaagttgcggttatggaaccct |
9629067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 10385762 - 10385714
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
10385762 |
ggcttaattgcacttttggacccctatctttccaaaagttgcgattatg |
10385714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 11578370 - 11578314
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| |||| |||||||||||||| |||| |
|
|
| T |
11578370 |
aggcttaattgtacttttggacccctatctttccaaaggttgcggttatggatccct |
11578314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 21954390 - 21954346
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
21954390 |
aaggcttaattgcacttttgaccccctatctttccaaaagttgcg |
21954346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 26872673 - 26872625
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
26872673 |
ggcttaattccacttttggacccttatcttttcaaaagttgcggttatg |
26872625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 201
Target Start/End: Original strand, 30085619 - 30085667
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
30085619 |
aaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30085667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 210
Target Start/End: Complemental strand, 39754180 - 39754132
Alignment:
| Q |
162 |
ttgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39754180 |
ttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39754132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 42751256 - 42751200
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||| |||| |||||||||||||||| |||||| |
|
|
| T |
42751256 |
aggcttaattgcacttttggacccttatttttttaaaagttgcggttatgaacccct |
42751200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 26872384 - 26872427
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
26872384 |
ttaattgcacttttgaacccctatatttccaaaagttgcggtta |
26872427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 201
Target Start/End: Complemental strand, 30086617 - 30086570
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
30086617 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30086570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 45863022 - 45863064
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45863022 |
aggcttaattgcacttttga-cccctatcttttcaaaagttgcg |
45863064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 201
Target Start/End: Original strand, 10715838 - 10715884
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
10715838 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
10715884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Original strand, 10986003 - 10986049
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
10986003 |
ttaattgcacttttagacctctatcttttcaaaagttgcggttatgg |
10986049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Original strand, 11275190 - 11275236
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
11275190 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatgg |
11275236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Complemental strand, 11742971 - 11742929
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11742971 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcg |
11742929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Complemental strand, 17802220 - 17802179
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17802220 |
ggcttaattgcacttttga-cccctatcttttcaaaagttgcg |
17802179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 21782915 - 21782861
Alignment:
| Q |
157 |
cttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
21782915 |
cttaattgcacttttggaccccctatctttccaaaagttgtggttatggacccct |
21782861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 30028396 - 30028446
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||| | |||||||||||| |||||||||||||||||||| |
|
|
| T |
30028396 |
cttaattgcactttaggacccctatctttctaaaagttgcggttatggacc |
30028446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 144 - 210
Target Start/End: Original strand, 33159473 - 33159539
Alignment:
| Q |
144 |
aattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||| ||||||||||||||||||| | |||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
33159473 |
aatttaattaaggcttaattgcacttttaaccccctatctttttaaaagttgcgattttggccccct |
33159539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 38053144 - 38053198
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| || ||||||||||| |
|
|
| T |
38053144 |
aaggcttaattgcacttttggacccctatctttccaaaaattttggttatggacc |
38053198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 39142505 - 39142463
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39142505 |
aaggcttaattgcacttttggtcccctatcttttcaaaagttg |
39142463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 49081643 - 49081597
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
49081643 |
ttaattgcacttttagatccctatcttttcaaaagttgcggttatgg |
49081597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 3931804 - 3931759
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
3931804 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
3931759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 196
Target Start/End: Original strand, 8409093 - 8409134
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8409093 |
ggcttaattgcacttttgacaccctatcttttcaaaagttgc |
8409134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 18201699 - 18201642
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||| || ||| ||||| |
|
|
| T |
18201699 |
aaggcttaattgcacttttggccccctgtcttttcaaaagttgcgattttggccccct |
18201642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 18798033 - 18798078
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
18798033 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
18798078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 194
Target Start/End: Complemental strand, 25683990 - 25683949
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
25683990 |
aaggcttaattgcacttttggacccctatctttccaaaagtt |
25683949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 29163098 - 29163155
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
29163098 |
aaggcttaattgcactttttgccccctatcttttcaaaagttgcgattttggccccct |
29163155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 37858366 - 37858326
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37858366 |
aggcttaattgcacttttga-cccctatcttttcaaaagttg |
37858326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 37996322 - 37996269
Alignment:
| Q |
158 |
ttaattgcacttttgaa-cccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37996322 |
ttaattgcatttttggatcccctatctttccaaaagttgcggttatggacccct |
37996269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 43408224 - 43408273
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||| |||||||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
43408224 |
ggcttaatttcacttttggacctctatctttccaaaagttgcggttatgg |
43408273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 3235117 - 3235169
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| ||| |||| |||| |
|
|
| T |
3235117 |
ttaattgcatttttgaactcctatcttttcaaaagttgcagttttggatccct |
3235169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 11578058 - 11578110
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
11578058 |
ttaattgtacttttggacccctatcattcaaaaagttgcggttatggacccct |
11578110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 16537391 - 16537339
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| |||||||| |||||||||| |
|
|
| T |
16537391 |
aggcttaattgcacttttggacccctgtctttcgaaaagttgtggttatggac |
16537339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 16628271 - 16628323
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| |||||||| |||||||||| |
|
|
| T |
16628271 |
aggcttaattgcacttttggacccctgtctttcgaaaagttgtggttatggac |
16628323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 17167853 - 17167896
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17167853 |
aaggcttaattgcacttttgg-cccctatcttttcaaaagttgcg |
17167896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 18798320 - 18798276
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
||||||||||||||| | |||||||||| |||||||||||||||| |
|
|
| T |
18798320 |
ttaattgcacttttggatccctatctttccaaaagttgcggttat |
18798276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 29163364 - 29163320
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
29163364 |
aaggcttaattgcacttttgaccttctatcttttcaaaagttgcg |
29163320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 30028693 - 30028641
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| || | ||||||||||||||||| ||||||||| |||| |
|
|
| T |
30028693 |
ttaattgcacttttggactcttatcttttcaaaagttgtggttatggatccct |
30028641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 38445407 - 38445459
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | |||||||||| |||||||| |||||||||||||| |
|
|
| T |
38445407 |
ttaattgcacttttggatccctatctttcaaaaagttgtggttatggacccct |
38445459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 45480140 - 45480100
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45480140 |
cttaattgcacttttggccccctatcttttcaaaagttgcg |
45480100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 79 - 150
Target Start/End: Complemental strand, 8314043 - 8313972
Alignment:
| Q |
79 |
gacctaacactatttatgactttatgactattattaatagatgctaatcataattctcaatgcacaattaaa |
150 |
Q |
| |
|
||||||| |||| |||||||| |||||| ||||||| |||||||||||| |||| || || ||| ||||||| |
|
|
| T |
8314043 |
gacctaaaactacttatgactctatgaccattattactagatgctaatcctaatgctaaaggcaaaattaaa |
8313972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 210
Target Start/End: Original strand, 24236134 - 24236169
Alignment:
| Q |
175 |
cccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24236134 |
cccctatctttccaaaagttgcggttatggacccct |
24236169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 203
Target Start/End: Complemental strand, 25036345 - 25036298
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||| ||||||| |
|
|
| T |
25036345 |
gcttaattgcacttttggatccctatctttttaaaagttgtggttatg |
25036298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 197
Target Start/End: Complemental strand, 36204492 - 36204453
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36204492 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
36204453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 41445972 - 41446015
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41445972 |
aggcttaattgcacttttggctccctatcttttcaaaagttgcg |
41446015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 40436288 - 40436234
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||| |||| ||||||| ||||||||||| |||||| ||||| |
|
|
| T |
40436288 |
gcttaattgcatttttggacccttatctttccaaaagttgcgattatggccccct |
40436234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 10385469 - 10385518
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
10385469 |
ggcttaattgcacttttagacccttatctttctaaaagttgcggttatgg |
10385518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16705747 - 16705702
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
16705747 |
cttaattgcatttttggacctttatcttttcaaaagttgcggttat |
16705702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 17679983 - 17679938
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
17679983 |
cttaattgcatttttggacctttatcttttcaaaagttgcggttat |
17679938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 20588466 - 20588413
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| || ||| ||||| |
|
|
| T |
20588466 |
cttaattgcacttttggccctctatcttttcaaaagttgcgattttggccccct |
20588413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 36801911 - 36801874
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36801911 |
ttaattgcacttttggccccctatcttttcaaaagttg |
36801874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 40139527 - 40139584
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
40139527 |
aaggcttaattgcacttttgggcccctatctttctaaaagttgcgattttggccccct |
40139584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 7195772 - 7195716
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||| ||| ||| ||| ||||||||||||||||||| |||| |
|
|
| T |
7195772 |
aggcttaattccacttttggacctatatttttccaaaagttgcggttatggatccct |
7195716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 7271437 - 7271485
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
7271437 |
gcttaattgcacttttggcccccctatcttttcaaaagttgcgattatg |
7271485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 10356116 - 10356172
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| |||| | | |||||||| |||||||||||||||||| ||||| |
|
|
| T |
10356116 |
aggcttaattgcatttttagatctctatctttccaaaagttgcggttatggccccct |
10356172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 11742712 - 11742752
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
11742712 |
cttaattgcacttttggccccctatctttttaaaagttgcg |
11742752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 21202917 - 21202873
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
21202917 |
aaggtttaattgcacttttggccccctatctttccaaaagttgcg |
21202873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 31530432 - 31530392
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
31530432 |
ggcttaattgcacttttggccccctatctttccaaaagttg |
31530392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 39977041 - 39976993
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||| ||||| ||||||||| |||||||| || |||||||| |
|
|
| T |
39977041 |
ggcttaattgcatttttggacccctatcctttcaaaaattacggttatg |
39976993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 40139876 - 40139832
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
40139876 |
aaggcttaattgcacttttggccccctatctttctaaaagttgcg |
40139832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 40790984 - 40790929
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
40790984 |
aggcttaattgcacttttgg-cccctatctttccaaaagttgcgattttggccccct |
40790929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 48925914 - 48925966
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
48925914 |
ttaattgcactttttgtcccctatcttttcaaaagttgcgattttggccccct |
48925966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 3e-22; HSPs: 123)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 30818530 - 30818473
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30818530 |
aaggcttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
30818473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 150 - 210
Target Start/End: Original strand, 7391480 - 7391540
Alignment:
| Q |
150 |
atgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7391480 |
atgaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7391540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 11322339 - 11322283
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11322339 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11322283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 1814976 - 1815031
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1814976 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1815031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 10977658 - 10977713
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977658 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
10977713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 2565076 - 2565133
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2565076 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
2565133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 5606612 - 5606555
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5606612 |
aaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
5606555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 9703859 - 9703802
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9703859 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9703802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 12256762 - 12256819
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12256762 |
aaggcgtaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
12256819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 31740767 - 31740824
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31740767 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
31740824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 2100695 - 2100639
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2100695 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
2100639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 153 - 205
Target Start/End: Complemental strand, 2565394 - 2565342
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2565394 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
2565342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 3185471 - 3185415
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3185471 |
aggcttaattgcacttttggtcccctatcttttcaaaagttgcggttatggacccct |
3185415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 4405555 - 4405499
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4405555 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4405499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 5606295 - 5606351
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5606295 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
5606351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 6261691 - 6261635
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6261691 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 11213497 - 11213441
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11213497 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11213441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 13042407 - 13042463
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13042407 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13042463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 23291255 - 23291311
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23291255 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23291311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 29696847 - 29696903
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29696847 |
aggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
29696903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 30965690 - 30965746
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30965690 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
30965746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 6261381 - 6261436
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6261381 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 11746292 - 11746237
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11746292 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
11746237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 23883089 - 23883144
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23883089 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
23883144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 1815291 - 1815234
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1815291 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
1815234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 3195718 - 3195771
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3195718 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
3195771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 10893887 - 10893944
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
10893887 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
10893944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 11745996 - 11746053
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
11745996 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggtcccct |
11746053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 15150043 - 15149986
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15150043 |
aaggtttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
15149986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 15711951 - 15711894
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15711951 |
aaggcttaattgcacttttcgacccctatctttttaaaagttgcggttatggacccct |
15711894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 20080116 - 20080173
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
20080116 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
20080173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 22279813 - 22279760
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22279813 |
aagggttaattgcacttttgaacccctatcttttcaaaaattgcggttatggac |
22279760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 27765256 - 27765313
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27765256 |
aaggattaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27765313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 28930777 - 28930724
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28930777 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatcgaccc |
28930724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 30966007 - 30965950
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
30966007 |
aaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
30965950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 31833581 - 31833524
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
31833581 |
aaggcttaattgcacttttggacccctatctttccaaaaattgcggttatggacccct |
31833524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 3535089 - 3535037
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3535089 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
3535037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 7391791 - 7391735
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
7391791 |
aggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
7391735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 11445979 - 11446031
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11445979 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
11446031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 11614897 - 11614953
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11614897 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
11614953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 14997008 - 14997064
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14997008 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14997064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 14997323 - 14997267
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14997323 |
aggcttaattgcacttttggacccctatctttgcaaaagttgcggttatagacccct |
14997267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 15273289 - 15273237
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15273289 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
15273237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 26716685 - 26716629
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
26716685 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
26716629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 27223623 - 27223567
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27223623 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
27223567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 28930465 - 28930517
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28930465 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggaccc |
28930517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29697157 - 29697101
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
29697157 |
aggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29697101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 31951515 - 31951463
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
31951515 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
31951463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 13042721 - 13042666
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
13042721 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
13042666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 15149727 - 15149778
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
15149727 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
15149778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 204
Target Start/End: Original strand, 15272996 - 15273047
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
15272996 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
15273047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 18683012 - 18683067
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
18683012 |
ggcttaattgcacttttggacctctatcttttcaaaagttgtggttatggacccct |
18683067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 23883401 - 23883346
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23883401 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
23883346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 25749955 - 25750010
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
25749955 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
25750010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 31833267 - 31833314
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31833267 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
31833314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 1897194 - 1897144
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1897194 |
aaggcttaattgcatttttgaacccctatctttccaaaagttgcggttatg |
1897144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 10977968 - 10977918
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977968 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
10977918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 148 - 202
Target Start/End: Original strand, 11277619 - 11277673
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11277619 |
aaattaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
11277673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 16735879 - 16735825
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
16735879 |
aggcttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
16735825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 22279500 - 22279554
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
22279500 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
22279554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 206
Target Start/End: Original strand, 30818219 - 30818269
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30818219 |
gcttgattgcacttttggacccctatcttttcaaaagttgcggttatggac |
30818269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 1896896 - 1896945
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
1896896 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
1896945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 11321900 - 11321957
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
11321900 |
aaggcttaattgcacttttggacccctatttttttaaaagttgtggttatggacccct |
11321957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 13439875 - 13439932
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
13439875 |
aaggattaattgcacttttgaactcctatctttccaaaagttgcgtttatggacccct |
13439932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 17965837 - 17965894
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
17965837 |
aaggtttaattgcacttttggatccctatcttttcaaaagttggggttatggacccct |
17965894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 18683325 - 18683268
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| |||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
18683325 |
aaggcttaatttcacttttggacccctatttttccaaaagttgcggttatggacccct |
18683268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 20630350 - 20630407
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
20630350 |
aaggcttaattgcacttatggacccctatctttccaaaagttgcggttatagacccct |
20630407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 28563635 - 28563578
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28563635 |
aaggcttaattgcacttttggacctctatctttcaaaaagttgcggttatggacccct |
28563578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 30239519 - 30239462
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
30239519 |
aaggcttaattgcacttttagacccctatctttccaaaagttgcagttatggacccct |
30239462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 31741082 - 31741029
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31741082 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
31741029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 31951198 - 31951259
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
|||| |||| ||||||||| ||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31951198 |
aaataaaggtttaattgcatttttggacccctatctttttaaaagttgcggttatggacccc |
31951259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 11615213 - 11615157
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11615213 |
aggcttaattgcacttttgggtccctatctttttaaaagttgcggttatggacccct |
11615157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 12257078 - 12257022
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
12257078 |
aggcttaattgcacttttggacctttatctttccaaaagttgcggttatggacccct |
12257022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 21003367 - 21003423
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
21003367 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
21003423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 28563326 - 28563382
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
28563326 |
aggcttaattgcacttttggacccctacctttctaaaagttgcggttatggacccct |
28563382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 34705689 - 34705637
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
34705689 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacc |
34705637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 10894183 - 10894128
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
10894183 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggccccct |
10894128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 16765041 - 16765096
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16765041 |
ggcttaattgtacttttggacccctatctttccaaaagttgcggttatgcacccct |
16765096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 20630662 - 20630607
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20630662 |
ggcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20630607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 152 - 207
Target Start/End: Complemental strand, 26171523 - 26171468
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
26171523 |
gaaggcttaattgcacttttggacccctatctttccaaaacttgcgattatggacc |
26171468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 27771527 - 27771472
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| |||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
27771527 |
ggcttaattacacttttggacccttatctttttaaaagttgcggttatggacccct |
27771472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 34705374 - 34705429
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
34705374 |
aaggcttaattgcatttttggacccctatattttcaaaagttgcggttctggaccc |
34705429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 8160599 - 8160641
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8160599 |
ggcttaattgcacttttgatcccctatcttttcaaaagttgcg |
8160641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 146 - 208
Target Start/End: Complemental strand, 10255842 - 10255780
Alignment:
| Q |
146 |
ttaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||| |||| ||||||||||||||| ||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
10255842 |
ttaaataaaggtttaattgcacttttggacccctatctttttaaaagttgcagttatagaccc |
10255780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 11277927 - 11277877
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
11277927 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatgaaccc |
11277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 2100379 - 2100428
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
2100379 |
aggcttaattgcacttttggacctctatctttccaaaagttgcggttatg |
2100428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 3196025 - 3195972
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||| |||||||||||| |
|
|
| T |
3196025 |
ggcttaattgcacttttggatccttatcttttcaaaagttgtggttatggaccc |
3195972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 3534800 - 3534853
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
3534800 |
cttaattacacttttggacccctatctttccaaaagttgcggttatggtcccct |
3534853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 4037036 - 4037093
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
4037036 |
aaggcttaattgcacttttggccccctatcttttcaaaagttgcgattttggccccct |
4037093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 15711637 - 15711690
Alignment:
| Q |
158 |
ttaattgcacttttgaacc-cctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
15711637 |
ttaattgcacttttggacctcctatcttttcaaaagttgcggttatggatccct |
15711690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 13440190 - 13440134
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| || | ||||||| ||||||||||||||| |||||||| |
|
|
| T |
13440190 |
aggcttaattgcacttttggactcttatctttccaaaagttgcggttacggacccct |
13440134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 16765351 - 16765296
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
16765351 |
aggcttaattgcacttttggacccctatctttac-aaagttgaggttatggacccct |
16765296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20080413 - 20080357
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20080413 |
aggcttaattgtacttttggacccctatctttgtaaaagttgcggttatggccccct |
20080357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 32591916 - 32591876
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32591916 |
ggcttaattgcacttttgaccccctatcttttcaaaagttg |
32591876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 28931948 - 28931995
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
28931948 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
28931995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 11307393 - 11307347
Alignment:
| Q |
151 |
tgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
11307393 |
tgaaggcttaattgcacttttggcctcctatcttttcaaaagttgcg |
11307347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 176 - 210
Target Start/End: Original strand, 11322043 - 11322077
Alignment:
| Q |
176 |
ccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11322043 |
ccctatcttttcaaaagttgcggttatggacccct |
11322077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 23585293 - 23585251
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
23585293 |
aaggcttaattgcacttttggacccctatctttccaaaagttg |
23585251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 201
Target Start/End: Complemental strand, 28932950 - 28932904
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
28932950 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
28932904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 148 - 194
Target Start/End: Original strand, 33274225 - 33274271
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33274225 |
aaataaaggcttaattgcacttttggccccctatcttttcaaaagtt |
33274271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 196
Target Start/End: Original strand, 6324202 - 6324243
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6324202 |
ggcttaattgcacttttggccccctatcttttcaaaagttgc |
6324243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 11109048 - 11109007
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
11109048 |
aggcttaattgcacttttgaccccttatcttttcaaaagttg |
11109007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 197
Target Start/End: Complemental strand, 31175878 - 31175837
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
31175878 |
gcttaattgcacttttaaccccctatcttttcaaaagttgcg |
31175837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Original strand, 7324658 - 7324702
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
||||||||| ||||| | ||||||||||||||||||||||||||| |
|
|
| T |
7324658 |
ttaattgcatttttggatccctatcttttcaaaagttgcggttat |
7324702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 12730650 - 12730594
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| || ||| ||||| |
|
|
| T |
12730650 |
aggcttaattgcacttttggcctcctatcttttcaaaagttgcgattttggtcccct |
12730594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 14168574 - 14168618
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
14168574 |
aaggcttaattgcacttttggccctctatcttttcaaaagttgcg |
14168618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 14169033 - 14168989
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14169033 |
aaggcttaattgcacttttggccccctatcttttcaaaatttgcg |
14168989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 3194750 - 3194699
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||||||||||| || | ||||||| |||||||||||||||||| |
|
|
| T |
3194750 |
aggcttaattgcacttttggactcatatctttctaaaagttgcggttatgga |
3194699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 193
Target Start/End: Complemental strand, 9126689 - 9126650
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagt |
193 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
9126689 |
aggcttaattgcacttttggacccctatctttccaaaagt |
9126650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 197
Target Start/End: Original strand, 24897094 - 24897133
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24897094 |
ttaattgcacttttgacctcctatcttttcaaaagttgcg |
24897133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 32591588 - 32591651
Alignment:
| Q |
147 |
taaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||||||||||| || ||| ||||| |
|
|
| T |
32591588 |
taaataaatgcttaattgcacttttggcaccctatcttttcaaaagttgcgattttggccccct |
32591651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 9067747 - 9067697
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||| ||||||||||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
9067747 |
aaggtttaattgcacttttggattcttatcttttcaaaagttgcggttatg |
9067697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Complemental strand, 9952227 - 9952186
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
9952227 |
ggcttaattgcacttttga-cccctatctttttaaaagttgcg |
9952186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 24418486 - 24418528
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24418486 |
ggcttaattgcacttttggcctcctatcttttcaaaagttgcg |
24418528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 378553 - 378497
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| |||||| || ||| ||||| |
|
|
| T |
378553 |
aaggcttaattgcacttttg-acccctatctttccaaatgttgcgattttggccccct |
378497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 194
Target Start/End: Original strand, 9951885 - 9951926
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
9951885 |
aaggcttaattgcacttttggccacctatcttttcaaaagtt |
9951926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 26479356 - 26479307
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||| | |||||| ||| |||||||||| ||||||| |
|
|
| T |
26479356 |
ggcttaattgcacttttggatccctatttttccaaaagttgcagttatgg |
26479307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 28960221 - 28960270
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
28960221 |
aaataaaggcttaattgtacttttggccccctatctttccaaaagttgcg |
28960270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 929517 - 929477
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
929517 |
cttaattgcacttttgaccccctatatttttaaaagttgcg |
929477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 17966151 - 17966096
Alignment:
| Q |
155 |
ggcttaattgcactttt-gaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| || |||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
17966151 |
ggcttaattgcacttttggaccccctatc-tttccaaagttgcggttatgaacccct |
17966096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 21008726 - 21008782
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
21008726 |
aggcttaattgcatttttagacctttatcttttcaaaagttgtggttatgaacccct |
21008782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 23350231 - 23350191
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23350231 |
cttaattgcacttttggccccttatcttttcaaaagttgcg |
23350191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 26479192 - 26479248
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||| ||||||||||| |||||| ||||| |
|
|
| T |
26479192 |
aggcttaattatacttttggacccttatctttccaaaagttgcgattatggccccct |
26479248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 3e-22; HSPs: 207)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 104515 - 104458
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
104515 |
aaggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
104458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 11530075 - 11530018
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11530075 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11530018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 34362818 - 34362875
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34362818 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34362875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 45289815 - 45289758
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45289815 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 46282758 - 46282815
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46282758 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggccccct |
46282815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 233005 - 232949
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
233005 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
232949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 1377604 - 1377660
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1377604 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
1377660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 7644456 - 7644512
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7644456 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
7644512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 18988178 - 18988234
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18988178 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18988234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 31250783 - 31250727
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31250783 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31250727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 54216270 - 54216215
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54216270 |
ggcttaattgcacttttgaacctctatcttttcaaaagttgcggttatggacccct |
54216215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 12640818 - 12640872
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12640818 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
12640872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 39136297 - 39136351
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39136297 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
39136351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 52310798 - 52310856
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52310798 |
gaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52310856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 11529757 - 11529814
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11529757 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11529814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 27246857 - 27246914
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27246857 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27246914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 41205496 - 41205553
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41205496 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 41205811 - 41205754
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41205811 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 41707720 - 41707773
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41707720 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41707773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 44921925 - 44921868
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44921925 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
44921868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 47853974 - 47854027
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47853974 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
47854027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 50513353 - 50513300
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50513353 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
50513300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 55586614 - 55586671
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55586614 |
aaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
55586671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 104199 - 104255
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
104199 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
104255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 7644773 - 7644717
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7644773 |
aggcttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
7644717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 14578754 - 14578698
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14578754 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
14578698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 23315692 - 23315636
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23315692 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23315636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 24415388 - 24415332
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24415388 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
24415332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 24542753 - 24542809
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24542753 |
aggcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
24542809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 37289454 - 37289510
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37289454 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37289510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 38371270 - 38371326
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38371270 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
38371326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 42672382 - 42672326
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42672382 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42672326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 45289499 - 45289555
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45289499 |
aggcttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 51537429 - 51537485
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51537429 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
51537485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 52045720 - 52045776
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52045720 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52045776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 52311116 - 52311060
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52311116 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52311060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 5344268 - 5344323
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5344268 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatagaccc |
5344323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 8482858 - 8482913
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8482858 |
aggcttaattgcacttttggacccctattttttcaaaagttgcggttatggacccc |
8482913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 11159733 - 11159678
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11159733 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11159678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 17262398 - 17262343
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17262398 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17262343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 17554359 - 17554304
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17554359 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
17554304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 20466385 - 20466440
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20466385 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
20466440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 34363131 - 34363076
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34363131 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgggcccct |
34363076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 35364196 - 35364251
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35364196 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
35364251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 50996035 - 50996090
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
50996035 |
ggcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
50996090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 7705589 - 7705643
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
7705589 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
7705643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 10046250 - 10046200
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10046250 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
10046200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 12641133 - 12641079
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
12641133 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
12641079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 22159830 - 22159884
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22159830 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
22159884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 37289768 - 37289714
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37289768 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
37289714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 39332612 - 39332562
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39332612 |
aggcttaattgcacttttgaacccctatctttttaaaagttgcggttatgg |
39332562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 5344586 - 5344529
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
5344586 |
aaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
5344529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 6386729 - 6386786
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
6386729 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
6386786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 7666198 - 7666255
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
7666198 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
7666255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 7705904 - 7705847
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| |
|
|
| T |
7705904 |
aaggcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
7705847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 20474026 - 20473969
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20474026 |
aaggcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
20473969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 31844099 - 31844046
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31844099 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
31844046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 35835774 - 35835831
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| || ||||||||||||||| |
|
|
| T |
35835774 |
aaggcttaattgcacttttggacccctatcttttcaaaatttacggttatggacccct |
35835831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 51696534 - 51696587
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
51696534 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
51696587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 52046031 - 52045974
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52046031 |
aaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
52045974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 52114449 - 52114392
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| |
|
|
| T |
52114449 |
aaggcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
52114392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 4902470 - 4902414
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
4902470 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
4902414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 7119908 - 7119856
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
7119908 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
7119856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 13021293 - 13021237
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
13021293 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
13021237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 13607916 - 13607972
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13607916 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
13607972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 14578437 - 14578493
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
14578437 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
14578493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 17262089 - 17262145
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17262089 |
aggcttaattgcactcttggaccactatcttttcaaaagttgcggttatggacccct |
17262145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20472860 - 20472804
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20472860 |
aggcttaattgtacttttggacccctatctttccaaaagttgcggttatggacccct |
20472804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 22160142 - 22160086
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22160142 |
aggcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
22160086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 26171240 - 26171296
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
26171240 |
aggcttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
26171296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 26675052 - 26675108
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26675052 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
26675108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 27751474 - 27751422
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27751474 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27751422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29432361 - 29432305
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29432361 |
aggcttaattgcacttttggatccctatcttttcaaaagttacggttatggacccct |
29432305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29548494 - 29548438
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29548494 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
29548438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 34957667 - 34957615
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34957667 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
34957615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35364509 - 35364453
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
35364509 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
35364453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 39332318 - 39332374
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39332318 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggccccct |
39332374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 47854294 - 47854238
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
47854294 |
aggcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
47854238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 51696843 - 51696787
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51696843 |
aggcttaatagcacttttggacccctatctttccaaaagttgcggttatggacccct |
51696787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 54215955 - 54216011
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
54215955 |
aggcttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
54216011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 55586931 - 55586875
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
55586931 |
aggcttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
55586875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 7666511 - 7666456
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7666511 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
7666456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 8891966 - 8891911
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8891966 |
ggcttaattgcactttaggacccctatcttttcaaaagttgtggttatggacccct |
8891911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 18988493 - 18988438
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
18988493 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggctatggacccct |
18988438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 21536880 - 21536935
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
21536880 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaaccct |
21536935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 27247172 - 27247117
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27247172 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27247117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 35083894 - 35083839
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
35083894 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcgattatggacccct |
35083839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 39136612 - 39136557
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
39136612 |
aaggcttaattgcacttttggacccctatctttccaaaagtagcggttatggaccc |
39136557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 48278229 - 48278174
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48278229 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
48278174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 7396139 - 7396189
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
7396139 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7396189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 17554043 - 17554097
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
17554043 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
17554097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 148 - 202
Target Start/End: Complemental strand, 37432538 - 37432484
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37432538 |
aaattaagacttaattgcacttttggacccctatcttttcaaaagttgcggttat |
37432484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 48277916 - 48277970
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48277916 |
ggcttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccc |
48277970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 6769107 - 6769054
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6769107 |
cttaattacacttttggacccctatcttttcaaaagttgtggttatggacccct |
6769054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 7119592 - 7119649
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||| |||||||||||||||||||||||| |
|
|
| T |
7119592 |
aaggcttaattgtacttttggatccctatctttccaaaagttgcggttatggacccct |
7119649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 8891656 - 8891709
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8891656 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8891709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 13019273 - 13019322
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
13019273 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
13019322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 20472552 - 20472601
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
20472552 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
20472601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 23419645 - 23419592
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
23419645 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
23419592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 30998499 - 30998442
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
30998499 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
30998442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 158 - 207
Target Start/End: Complemental strand, 34158783 - 34158734
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
34158783 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacc |
34158734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 38371579 - 38371522
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
38371579 |
aaggcttaatcgcacttttggacctctatcttttcaaaaattgcggttatggacccct |
38371522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 43821719 - 43821768
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
43821719 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
43821768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 50513043 - 50513100
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |||||||| |||| |
|
|
| T |
50513043 |
aaggcttaattgcacttttggactcctatcttttcaaaagttgcagttatggatccct |
50513100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 54556613 - 54556666
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
54556613 |
aggcttaattgcacttttggacccctatttttccaaaagttgcggttatggacc |
54556666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 54556930 - 54556873
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
54556930 |
aaggcttaattgcacttttggacctctatctttctaaaagttgcggttatggacccct |
54556873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 3770473 - 3770425
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
3770473 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttatg |
3770425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 4107814 - 4107762
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
4107814 |
ttaattgcacttttgaacccttatctttttaaaagttgcggttatggatccct |
4107762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 4902135 - 4902191
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
4902135 |
aggcttaattgcacttttggacccctatctttccaaaagttgctgttatggccccct |
4902191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 8483174 - 8483118
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
8483174 |
aggcttaattgcacttttggacctctattttttcaaaagttgcggttatagacccct |
8483118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 17221617 - 17221561
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
|||||||||||| ||||||| | || ||||||||||||||||||||||||||||||| |
|
|
| T |
17221617 |
aaggcttaattgtacttttggatccttatcttttcaaaagttgcggttatggacccc |
17221561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 21537191 - 21537135
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
21537191 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcacttttggacccct |
21537135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 24415072 - 24415128
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
24415072 |
aggcttaattgcacttttggacccctatctttccaaaagttgcagttatggatccct |
24415128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 24543053 - 24543001
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
24543053 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatggatccct |
24543001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 26675369 - 26675314
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
26675369 |
aggcttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
26675314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 28158899 - 28158951
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||| |||| |
|
|
| T |
28158899 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggatccct |
28158951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 28981912 - 28981968
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28981912 |
aggcttatatgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
28981968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 29548179 - 29548235
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||| ||||||| |
|
|
| T |
29548179 |
aggcttaattgcacttttggacccttatctttccaaaagttgcggttatagacccct |
29548235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29627921 - 29627865
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29627921 |
aggcttagttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
29627865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 31209528 - 31209476
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31209528 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
31209476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 34957377 - 34957432
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
34957377 |
aggcttaattgcacttttggatcc-tatcttttcaaaagttgcggttatggacccct |
34957432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 35083579 - 35083635
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | ||||||| |||||||||||||| |
|
|
| T |
35083579 |
aggcttaattgcacttttgaacctctatctttccgaaagttggggttatggacccct |
35083635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 47821474 - 47821530
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
47821474 |
aggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggccccct |
47821530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 151 - 210
Target Start/End: Complemental strand, 26171557 - 26171498
Alignment:
| Q |
151 |
tgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||||||||||||||| |||||||||| |||| |
|
|
| T |
26171557 |
tgaagacttaattgcacttttggacctctatcttttcaaaagttacggttatggatccct |
26171498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 39946390 - 39946335
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
39946390 |
ggcttaattgcacttttggacccttatctttccaaaagttgtggttatggacccct |
39946335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 44921602 - 44921669
Alignment:
| Q |
143 |
caattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
44921602 |
caattaaaaaaaggtttaattgcacttttggacccttatctttttaaaagttgcggttatggatccct |
44921669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 51537929 - 51537874
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
51537929 |
ggcttaatttcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51537874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 23770077 - 23770031
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
23770077 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
23770031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 31209225 - 31209279
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
31209225 |
gcttaattggacttttggacccatatctttccaaaagttgcggttatggacccct |
31209279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 33338350 - 33338288
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
33338350 |
aaattaaggcttaattgcacttttggacccctatctttctaaaagttgcggttctggccccct |
33338288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 41788378 - 41788328
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||| | ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41788378 |
aggcttaattgcagtgttgaacctctatcttttcaaaagttgcggttatgg |
41788328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 51537737 - 51537691
Alignment:
| Q |
162 |
ttgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
51537737 |
ttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
51537691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 56296619 - 56296665
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
56296619 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
56296665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 1377901 - 1377852
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
1377901 |
aggctaaattgcactttaggacccctatcttttcaaaagttgcggttatg |
1377852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 6387047 - 6386990
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
6387047 |
aggcttaattgcacttttggaccccctatctttctaaaagttgcggttatggacccct |
6386990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 27751161 - 27751218
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||| ||||||||| |||||||||||||| |
|
|
| T |
27751161 |
aaggcttaattgcacttttggacctctatgtttccaaaagttgtggttatggacccct |
27751218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 31843785 - 31843838
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||| |||||| |||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
31843785 |
aaggtttaattacacttttggacccctatcttttcaaaagttgtggttatggac |
31843838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 43822012 - 43821963
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
43822012 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatg |
43821963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 56296913 - 56296856
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||| || || ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
56296913 |
aaggtttaattgcatttctggacccctatcttttcaaaagttgcggttatggtcccct |
56296856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 2016248 - 2016296
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2016248 |
aaataaaggcttaattgcacttttggccccctatcttttcaaaagttgc |
2016296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 4107508 - 4107560
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
4107508 |
ttaattgcatttttggacccctatcttttcaaaagttacagttatggacccct |
4107560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 6768800 - 6768852
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
6768800 |
ttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
6768852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 13608235 - 13608179
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||| || |||||||||| |||||||||||||||||| |||| |
|
|
| T |
13608235 |
aggcttaattacacttttggactcctatctttttaaaagttgcggttatggaaccct |
13608179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 23769803 - 23769859
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||| |||| |||||||| |||||||| ||||| |
|
|
| T |
23769803 |
aggcttaattgcacttttggacccctatttttttaaaagttgtggttatggccccct |
23769859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 24296815 - 24296771
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24296815 |
aaggcttaattgcacttttgacctcctatcttttcaaaagttgcg |
24296771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 28982222 - 28982170
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
28982222 |
ttaattgcacttttggacctatattttttcaaaagttgcggttatggacccct |
28982170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 30998182 - 30998238
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
30998182 |
aggcttaactgcacttttagacctctatctttccaaaagttgcggttatggacccct |
30998238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 34158474 - 34158526
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||| ||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
34158474 |
ttaattgcatttttggacccctatctttccaaaaattgcggttatggacccct |
34158526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 37973516 - 37973568
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
37973516 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
37973568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 37973829 - 37973773
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||||||||| || ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37973829 |
aggcttagttgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
37973773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 3065959 - 3066006
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
3065959 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
3066006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 9592453 - 9592402
Alignment:
| Q |
146 |
ttaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||| | |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9592453 |
ttaaataatggcttaattgcacttttggccccctatcttttcaaaagttgcg |
9592402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 10045956 - 10046010
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
10045956 |
ggcttaattgcacttttggacccctatc-tttccaaagttgcggttatggccccct |
10046010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 17266060 - 17266013
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
17266060 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttat |
17266013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 31250481 - 31250528
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
31250481 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatgga |
31250528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 204
Target Start/End: Complemental strand, 33508261 - 33508210
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
33508261 |
aaggcttaatttcacttttggacccctatctttccaaaagttgcggtaatgg |
33508210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 39946079 - 39946134
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
39946079 |
aggcttaattgcacttttggaccattatctttctaaaagttgcggttatggacccc |
39946134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 49869733 - 49869690
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
49869733 |
aggcttaattgcacttttgacctcctatcttttcaaaagttgcg |
49869690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 19693018 - 19693072
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||||| ||||| |||||||| |
|
|
| T |
19693018 |
gcttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19693072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 19703603 - 19703657
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||||| ||||| |||||||| |
|
|
| T |
19703603 |
gcttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19703657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 19869468 - 19869422
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
19869468 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
19869422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 196
Target Start/End: Original strand, 24886531 - 24886573
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24886531 |
aggcttaattgcacttttggtcccctatcttttcaaaagttgc |
24886573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 36945513 - 36945555
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36945513 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcg |
36945555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 41787048 - 41787098
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
41787048 |
aggcttaattgcacttttggacccctatctttcaaaaaattgcggttatgg |
41787098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 47821638 - 47821588
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
47821638 |
aaggcttaattgcacttttagacccctatctttccgaaagttgcggttatg |
47821588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 51239985 - 51240027
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
51239985 |
ggcttaattgcacttttgaccccctatcttttcaaaaattgcg |
51240027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 1187001 - 1186960
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1187001 |
ggcttaattgcacttttggccccctatcttttcaaaagttgc |
1186960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 197
Target Start/End: Original strand, 12892825 - 12892866
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12892825 |
gcttaattgcacttttggccccctatcttttcaaaagttgcg |
12892866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 205
Target Start/End: Original strand, 17265850 - 17265899
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||| ||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
17265850 |
gcttaattgtacttttggacccctatctttctaaaagttgcggttatgga |
17265899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 18994670 - 18994715
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
18994670 |
ttaattgcacttttggacccctatctttcgaaaagttgcggttatg |
18994715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 26858342 - 26858399
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
26858342 |
aaggcttaattgcacttttggccccctatctttttaaaagttgcgattttggtcccct |
26858399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 197
Target Start/End: Original strand, 29860653 - 29860694
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29860653 |
gcttaattgcacttttggccccctatcttttcaaaagttgcg |
29860694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 40350838 - 40350891
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| |||||||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
40350838 |
cttaactgcacttttggattcctattttttcaaaagttgcggttatggacccct |
40350891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 40351148 - 40351095
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||| ||| |||| ||||||||||||||| ||||||| |
|
|
| T |
40351148 |
cttaattgcacttttggacccttatttttttaaaagttgcggttatagacccct |
40351095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 42672070 - 42672115
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42672070 |
cttaattgcacttttggacccctatctttcaaaaagttgcggttat |
42672115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 54606886 - 54606934
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
54606886 |
aaggcttaattgta-ttttggacccctatcttttcaaaagttgcggttat |
54606934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 3770178 - 3770234
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
3770178 |
aggcttaattgcacttttggacccctatctttcttaaagttgcgattatggccccct |
3770234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 18995116 - 18995068
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||| | ||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
18995116 |
ggcttaattgtatttttggacccctatctttccaaaagttgcggttatg |
18995068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 20466679 - 20466643
Alignment:
| Q |
174 |
acccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20466679 |
acccctatctttccaaaagttgcggttatggacccct |
20466643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 29432050 - 29432102
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||||||| || |||||| |
|
|
| T |
29432050 |
ttaattgcacttttggacccctatctttccaaaaattgcggttgtgaacccct |
29432102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 49869251 - 49869295
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49869251 |
aaggcttaattgcacttttggctccctatcttttcaaaagttgcg |
49869295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 201
Target Start/End: Complemental strand, 3066841 - 3066794
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
||||||||||||||||||| |||| || |||| ||||||||||||||| |
|
|
| T |
3066841 |
aggcttaattgcacttttggacccataactttccaaaagttgcggtta |
3066794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 197
Target Start/End: Complemental strand, 13306963 - 13306924
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13306963 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
13306924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 23777378 - 23777335
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
23777378 |
aggcttaattgctcttttgaccccttatcttttcaaaagttgcg |
23777335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 44121102 - 44121059
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44121102 |
aggcttaattacacttttggccccctatcttttcaaaagttgcg |
44121059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 45904255 - 45904216
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
45904255 |
cttaattgcacttttgacctcctatcttttcaaaagttgc |
45904216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 54607193 - 54607138
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||| |||||| ||||||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
54607193 |
aaggtttaattttacttttggatccctatcttttcaaaagttgcggttatgaaccc |
54607138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 10726249 - 10726208
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
10726249 |
aggcttaattgcactttt-aaccactatcttttcaaaagttgc |
10726208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 10940018 - 10939977
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
10940018 |
aggcttaattgcactttt-aaccactatcttttcaaaagttgc |
10939977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 12893277 - 12893235
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
12893277 |
aggcttaattgcacttttggccccctatcttttcaaatgttgc |
12893235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Complemental strand, 19957037 - 19956995
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
19957037 |
ggcttaattgcatttttgatcctctatcttttcaaaagttgcg |
19956995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Complemental strand, 36414021 - 36413979
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
36414021 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
36413979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Original strand, 44822438 - 44822480
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
44822438 |
aggcttaattgcacctttggacccctatctttccaaaagttgc |
44822480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 1186656 - 1186713
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| |||||||||| || ||| ||||| |
|
|
| T |
1186656 |
aaggcttaattgcacttttggccccctaactttttaaaagttgcgattttggccccct |
1186713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 194
Target Start/End: Original strand, 44120754 - 44120795
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44120754 |
aaggtttaattgcacttttggccccctatcttttcaaaagtt |
44120795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 144 - 197
Target Start/End: Complemental strand, 50073620 - 50073567
Alignment:
| Q |
144 |
aattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
50073620 |
aattaaatctaggcttaattgcacttttggtcccttatctttttaaaagttgcg |
50073567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 194
Target Start/End: Complemental strand, 51843602 - 51843565
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51843602 |
cttaattgcacttttggccccctatcttttcaaaagtt |
51843565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 52114134 - 52114187
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||| ||||||| | ||||||||||||||||| ||||||||| |||| |
|
|
| T |
52114134 |
aggcttaattacactttttgatccctatcttttcaaaagatgcggttatagacc |
52114187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 55733003 - 55732946
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
55733003 |
aaggcttaattgcacttttggctccctatctttttaaaagttgcgattttggccccct |
55732946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 3556227 - 3556187
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
3556227 |
ggcttaattgcatttttggccccctatcttttcaaaagttg |
3556187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 33338049 - 33338097
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||| ||||||| |||| ||| ||| ||||||||||||||||| |
|
|
| T |
33338049 |
ggcttaattgtacttttggacccatatatttccaaaagttgcggttatg |
33338097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 34625284 - 34625240
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
34625284 |
aaggtttaattgcacttttggcctcctatcttttcaaaagttgcg |
34625240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 39907398 - 39907358
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
39907398 |
aggcttaattgcacttttggtcccctatctttttaaaagtt |
39907358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 196
Target Start/End: Complemental strand, 44932913 - 44932873
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
44932913 |
gcttaattgcatttttggtcccctatcttttcaaaagttgc |
44932873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 46283057 - 46282999
Alignment:
| Q |
155 |
ggcttaattgcact---tttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
46283057 |
ggcttaattgcactatctttggacccctatctttctaaaagttgcggttatggccccct |
46282999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 47096734 - 47096683
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
47096734 |
ttaattgcacttttgg-cccctatcttttcaaaagttgcgattttggccccct |
47096683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 194
Target Start/End: Original strand, 50141880 - 50141920
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagtt |
194 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
50141880 |
aggcttaattgcacttttgatctcctatctttttaaaagtt |
50141920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 3e-22; HSPs: 149)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 24205292 - 24205349
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24205292 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24205349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 31784250 - 31784307
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31784250 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31784307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 40493960 - 40493903
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40493960 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40493903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 24895225 - 24895169
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24895225 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24895169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 41071828 - 41071884
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41071828 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
41071884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 22194761 - 22194706
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22194761 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22194706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 39642729 - 39642784
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39642729 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
39642784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 22093534 - 22093476
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22093534 |
gaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
22093476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 1375472 - 1375419
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1375472 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1375419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 1467123 - 1467066
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1467123 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
1467066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 2936787 - 2936844
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2936787 |
aaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
2936844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 13485488 - 13485431
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13485488 |
aaggcttaattgcacttttatacccctatcttttcaaaagttgcggttatggacccct |
13485431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 45127155 - 45127094
Alignment:
| Q |
149 |
aatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
45127155 |
aatgaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45127094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 19256903 - 19256847
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19256903 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19256847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 20436057 - 20436113
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20436057 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
20436113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 22093234 - 22093290
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22093234 |
aggcttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22093290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 1466810 - 1466865
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1466810 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1466865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 21552541 - 21552596
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21552541 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
21552596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 21552854 - 21552799
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21552854 |
ggcttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
21552799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 36987726 - 36987671
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36987726 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36987671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 39431482 - 39431427
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
39431482 |
ggcttaattgcacttttgaacctctatctttttaaaagttgcggttatggacccct |
39431427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 40493646 - 40493701
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40493646 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
40493701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 15977521 - 15977467
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15977521 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
15977467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 7464266 - 7464197
Alignment:
| Q |
141 |
cacaattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| || ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7464266 |
cacaataaaaagaaggcttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
7464197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 8519269 - 8519318
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8519269 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacc |
8519318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 23000824 - 23000767
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
23000824 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
23000767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 25888206 - 25888149
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25888206 |
aaggcttaattgcacttttggacccctatctttacaaaagttacggttatggacccct |
25888149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 33004708 - 33004761
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
33004708 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacc |
33004761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 33005007 - 33004950
Alignment:
| Q |
154 |
aggcttaattgcacttttgaa-cccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33005007 |
aggcttaattgcacttttggatcccctatcttttcaaaagttgcggttatggacccct |
33004950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 35699167 - 35699110
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35699167 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35699110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 36589729 - 36589786
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
36589729 |
aaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggccccct |
36589786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 40711334 - 40711391
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40711334 |
aaggcttaattgtatttttggacccctatcttttcaaaagttgcggttatggacccct |
40711391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 42445370 - 42445427
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42445370 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42445427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 2382871 - 2382815
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
2382871 |
aggcttaattgcacttttaaacccctatatttccaaaagttgcggttatggacccct |
2382815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 11362564 - 11362612
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11362564 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
11362612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 19025822 - 19025878
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19025822 |
aaggcttaattgcactttttgacccctatcttttcaaaagttgcggttatgaacccc |
19025878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 22194447 - 22194503
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22194447 |
aggcttaatttcatttttggacccctatcttttcaaaagttgcggttatggacccct |
22194503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 24858190 - 24858134
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||| |||||| |
|
|
| T |
24858190 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
24858134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 25429921 - 25429977
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
25429921 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
25429977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 31784565 - 31784509
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31784565 |
aggcttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
31784509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 40324633 - 40324689
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |||||||||||| |
|
|
| T |
40324633 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcgattatggacccct |
40324689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 41072142 - 41072086
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41072142 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
41072086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 41829775 - 41829723
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41829775 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
41829723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 1375046 - 1375101
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
1375046 |
ggcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
1375101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 17798848 - 17798903
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
17798848 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
17798903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 20494339 - 20494394
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
20494339 |
ggcttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
20494394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 22699456 - 22699511
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22699456 |
ggcttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
22699511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 204
Target Start/End: Complemental strand, 36590027 - 36589976
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
36590027 |
aaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatgg |
36589976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 36987412 - 36987467
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
36987412 |
ggcttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccct |
36987467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 202
Target Start/End: Original strand, 38731279 - 38731326
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38731279 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38731326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 19368808 - 19368758
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
19368808 |
aaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
19368758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 21568237 - 21568183
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21568237 |
gcttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
21568183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 1375397 - 1375344
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||| ||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1375397 |
cttaattgaacttttggacccctatctttccaaaagttgcggttatggacccct |
1375344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 8739139 - 8739094
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8739139 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
8739094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 9484703 - 9484756
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9484703 |
cttaattgcacttttaaacctctatctttccaaaagttgcggttatggacccct |
9484756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 17799144 - 17799087
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
17799144 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
17799087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 19026132 - 19026075
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
19026132 |
aaggtttaattgcacttttgaatccctatctttccaaaagttgcggttatagacccct |
19026075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 156 - 205
Target Start/End: Original strand, 24894970 - 24895019
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
24894970 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatgga |
24895019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 25430085 - 25430028
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
25430085 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggccccct |
25430028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 25887893 - 25887946
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
25887893 |
aggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacc |
25887946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 38731594 - 38731537
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
38731594 |
aaggcttaattgcacttttggactcctatcttttcaaaagttgcagttattgacccct |
38731537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 39620543 - 39620600
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
39620543 |
aaggcttaattgcacttttgggtccctatctttccaaaagttgcggttatggacccct |
39620600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 315021 - 315073
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
315021 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
315073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 1374801 - 1374853
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1374801 |
ttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
1374853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 7537412 - 7537468
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
7537412 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
7537468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 9714861 - 9714917
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |||||||||||| ||||| |
|
|
| T |
9714861 |
aaattaaggcttaattgcacttttgaactcctatctttccaaaagttgcggctatgg |
9714917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 9715163 - 9715107
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
9715163 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggtcatggccccct |
9715107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 13732481 - 13732425
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
13732481 |
aggcttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
13732425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20436367 - 20436311
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||| |||||||| |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
20436367 |
aggcttaattacacttttggacccctattttttcaaaagttgctgttatggacccct |
20436311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 26717455 - 26717399
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
26717455 |
aggcttaattgcacttttggacccatatctttccaaaagttgcggttatggccccct |
26717399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 39431172 - 39431224
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
39431172 |
ttaattgcacttttgaacttctatctttccaaaagttgcggttatggacccct |
39431224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 42445686 - 42445630
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
42445686 |
aggcttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
42445630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 7463949 - 7464000
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
7463949 |
cttaattgcacttttgaacccctatctttttaaaagttgtggttatgtaccc |
7464000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 13123424 - 13123475
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
13123424 |
cttaattgcacttttggacccctatctttttaaaagttgaggttatggaccc |
13123475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 21024775 - 21024732
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21024775 |
aggcttaattgcacttttgaccccctatcttttcaaaagttgcg |
21024732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 21843493 - 21843438
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
21843493 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
21843438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 167 - 210
Target Start/End: Complemental strand, 24205597 - 24205554
Alignment:
| Q |
167 |
cttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24205597 |
cttttggacccctatcttttcaaaagttgcggttatggacccct |
24205554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 34850970 - 34850915
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
34850970 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatggccccct |
34850915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 36566605 - 36566652
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
36566605 |
cttaattgcacttctggacccctatcttttcaaaagttgcggttatgg |
36566652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 41829467 - 41829522
Alignment:
| Q |
154 |
aggcttaattgcactttt-gaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
41829467 |
aggcttaattgcactttttggacccctatctttccaaaagttgcggttatggaccc |
41829522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 3263034 - 3263084
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
3263034 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttatgg |
3263084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 3263336 - 3263274
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3263336 |
aaataaaggcttacttgcacttttggacccctatctttctaaaagttgcggttatggccccct |
3263274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 200
Target Start/End: Complemental strand, 10741392 - 10741346
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggtt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10741392 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcggtt |
10741346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 11366796 - 11366854
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccc-tatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
11366796 |
aaggcttaattacacttttggaccccctatctttccaaaagttgcggttatggacccct |
11366854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 11367114 - 11367060
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
11367114 |
aggcttaattgcacttttggacccttatctttccaaaagttgcggctatggaccc |
11367060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 201
Target Start/End: Complemental strand, 17102622 - 17102576
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
17102622 |
ggcttaattgcacttttgaacccctaactttccaaaagttgcggtta |
17102576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 30219021 - 30218971
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
30219021 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
30218971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 36566766 - 36566716
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
36566766 |
aaggcttaattgcacttctggacccctatctttccaaaagttgcggttatg |
36566716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 40506204 - 40506258
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
40506204 |
gcttaattgcacttttggaccccaatctttccaaaagttgcggttatggccccct |
40506258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 195
Target Start/End: Original strand, 40938792 - 40938834
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40938792 |
aaggcttaattgcacttttgaccccctatcttttcaaaagttg |
40938834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 45126840 - 45126894
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||| | | |||||||||||||||||||||||| |
|
|
| T |
45126840 |
gcttaattgcacttttggacccctatatatccaaaagttgcggttatggacccct |
45126894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 2755265 - 2755208
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
2755265 |
aaggcttaattgcacttttggccccctatcttttcaaaagttgcgattttggccccct |
2755208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 5036507 - 5036564
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || | |||||||| ||||||||||||||||| ||||| |
|
|
| T |
5036507 |
aaggcttaattgcacttttggactcttatctttttaaaagttgcggttatggccccct |
5036564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 11188308 - 11188361
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
11188308 |
cttaattgcacttttgaccccctatcttttcaaaagttgcgattttggccccct |
11188361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 11362872 - 11362819
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11362872 |
cttaattatacttttggacccctatcatttcaaaagttgcggttatggacccct |
11362819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 24857881 - 24857934
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
24857881 |
aaggtttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
24857934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 207
Target Start/End: Complemental strand, 34981692 - 34981643
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34981692 |
ttaattgcatttttagacccctatcttttcaaaagttgcggttatggacc |
34981643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 39620863 - 39620806
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||| ||||||||||||| ||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
39620863 |
aaggctaaattgcacttttggacctctattttttcaaaatttgcggttatggacccct |
39620806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 40324941 - 40324888
Alignment:
| Q |
158 |
ttaattgcactttt-gaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40324941 |
ttaattgcactttttggacccctatctttccaaaagttgcggttatggacccct |
40324888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 45395233 - 45395286
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
45395233 |
cttaattgcacttttggacccctacctttccaaaagttgcggttatgtacccct |
45395286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 45395553 - 45395496
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||| |||||||||||||||||| |
|
|
| T |
45395553 |
aaggcttaattgcacttttggatccctatctttctaaaaattgcggttatggacccct |
45395496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 32661402 - 32661446
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32661402 |
aaggcttaattgcacttttggccccctatcttttcaaaagttgcg |
32661446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 34123245 - 34123296
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
34123245 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
34123296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 34123555 - 34123503
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
34123555 |
aggcttaattgcacttttagacccctattttttaaaaagttgcggttatggac |
34123503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 39245979 - 39245927
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
206 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||||||||| |||||||| |
|
|
| T |
39245979 |
aggcttaattgcacttttggacccatatctttccaaaagttgcgattatggac |
39245927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 197
Target Start/End: Complemental strand, 3414910 - 3414871
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3414910 |
ttaattgcacttttgaacccctatctttccaaaagttgcg |
3414871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 19473076 - 19473131
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
19473076 |
ggcttaattgcatttttggacccctatctttctaaaagttgcggttatggccccct |
19473131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 22136891 - 22136946
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| | ||||||||||| |
|
|
| T |
22136891 |
aaggcttaattgcacttttagacccctatctttccaaaagttacagttatggaccc |
22136946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 31025874 - 31025917
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31025874 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcg |
31025917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 196
Target Start/End: Complemental strand, 39374445 - 39374402
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
39374445 |
aaggcttaattgcacttttgaccccctatattttcaaaagttgc |
39374402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 41454511 - 41454554
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41454511 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcg |
41454554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 315317 - 315267
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
315317 |
aggcttaattgcacttttggacccatatctttctaaaagttgcggttatgg |
315267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 19473325 - 19473279
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
19473325 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatgg |
19473279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 26717155 - 26717213
Alignment:
| Q |
152 |
gaaggcttaattgcacttttgaacccctatcttttcaaaagt-tgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
26717155 |
gaaggcttaattgcacttttggacccctatctttccaaaagtacgcggttatggccccc |
26717213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 34470029 - 34470071
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34470029 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcg |
34470071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 2937103 - 2937047
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2937103 |
aaggcttaattgca-ttttggacctctatctttctaaaagttgcggttatggacccct |
2937047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 11017603 - 11017660
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
11017603 |
aaggcttaattgtacttttggaccccaatctttcaaaaagttgcggttatagacccct |
11017660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 199
Target Start/End: Complemental strand, 16238533 - 16238492
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggt |
199 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
16238533 |
ttaattgcatttttgatcccctatcttttcaaaagttgcggt |
16238492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 19889538 - 19889489
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19889538 |
aaataaaggcttaattgcacttttggccccatatcttttcaaaagttgcg |
19889489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 36286469 - 36286412
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
36286469 |
aaggcttaattgcacttttggccccctatctttccaaaagttgcgattttggccccct |
36286412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 40445572 - 40445621
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||| |||||||||||| |
|
|
| T |
40445572 |
aggcttaattgcacttttggacccatatctttccaaacgttgcggttatg |
40445621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 201
Target Start/End: Complemental strand, 40445873 - 40445820
Alignment:
| Q |
148 |
aaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
40445873 |
aaataaaggcttaattgcacttttggacccctatctttctaaaagttgtggtta |
40445820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 8738847 - 8738895
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||| |||||||||| |
|
|
| T |
8738847 |
aggcttaattgcacttttggacccctacctttacaaaaattgcggttat |
8738895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 12542471 - 12542415
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||| || ||| ||||| |
|
|
| T |
12542471 |
aggcttaattgcacttttggccctctatcttttcaaaagttgcgattttggccccct |
12542415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 15977207 - 15977263
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| || |||||| ||||||||||||| |
|
|
| T |
15977207 |
aggcttaattgcacttttggacccctatttttccagaagttgtagttatggacccct |
15977263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 23000530 - 23000582
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||| ||| ||| |||||||||||||||||| ||||| |
|
|
| T |
23000530 |
ttaattgcacttttggacccttatttttccaaaagttgcggttatggccccct |
23000582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 34981386 - 34981437
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
34981386 |
gcttaattgcatttttggaccc-tatcttttcaaaagttgcggttatagaccc |
34981437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 37343998 - 37343954
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
37343998 |
aaggcttaattgcacttttggcctcctatcttttcaaaagttgcg |
37343954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 39374098 - 39374142
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
39374098 |
aaggcttaattgcacttttggccctctatcttttcaaaagttgcg |
39374142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 41454857 - 41454813
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
41454857 |
aaggcttaattgcacgtttggccccctatcttttcaaaagttgcg |
41454813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 10857339 - 10857394
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
10857339 |
ggcttaattgcacttttggccccctatctttccaaaagttgcgattttggccccct |
10857394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 13123734 - 13123679
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| || | |||||| |||||||||||| || |||||||||||| |
|
|
| T |
13123734 |
ggcttaattgcacttatggatccctattttttcaaaagttacgtttatggacccct |
13123679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 17096910 - 17096957
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
||||||||||||||||||| | ||||| |||| ||||||||||||||| |
|
|
| T |
17096910 |
aggcttaattgcacttttggatccctaactttccaaaagttgcggtta |
17096957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 32661748 - 32661693
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
32661748 |
ggcttaattgcacttttggccccctatctttccaaaagttgcgattttggccccct |
32661693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 34600546 - 34600589
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
34600546 |
aggcttaattgcacttttggccccctatctttccaaaagttgcg |
34600589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 204
Target Start/End: Original strand, 34850675 - 34850726
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||| ||||||||||||||| |||| ||| ||| |||||||||||||||||| |
|
|
| T |
34850675 |
aaggtttaattgcacttttggacccttatttttccaaaagttgcggttatgg |
34850726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 197
Target Start/End: Original strand, 34922227 - 34922266
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34922227 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
34922266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 37334604 - 37334646
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37334604 |
aggcttaattgcacttttgg-cccctatcttttcaaaagttgcg |
37334646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 191
Target Start/End: Complemental strand, 3339201 - 3339163
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaa |
191 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3339201 |
aaggcttaattgcacttttggccccctatcttttcaaaa |
3339163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 12542141 - 12542179
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12542141 |
cttaattgcacttttggccccctatcttttcaaaagttg |
12542179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 11134053 - 11134016
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttg |
195 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11134053 |
ttaattgcacttttggtcccctatcttttcaaaagttg |
11134016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 155 - 196
Target Start/End: Original strand, 16865319 - 16865360
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
16865319 |
ggcttaattgcacttttggccccctatctttccaaaagttgc |
16865360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 19885861 - 19885913
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
19885861 |
cttaattgcacttttgg-cccctatcttttcaaaagttgcgattttggccccct |
19885913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 24365180 - 24365135
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||| ||||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
24365180 |
ttaattgcatttttggacctctatctttccaaaagttgcggttatg |
24365135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 36286121 - 36286178
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| || |||| ||||||||||||||| || ||| ||||| |
|
|
| T |
36286121 |
aaggcttaattgcacttttggccctctatattttcaaaagttgcgattttggccccct |
36286178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 4094870 - 4094830
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4094870 |
cttaattgcactttttgccccctatcttttcaaaagttgcg |
4094830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 23280945 - 23280889
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
23280945 |
aggcttaattgcacttttgtccccctatctttctaaaagttgcgattttggccccct |
23280889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 35173124 - 35173085
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35173124 |
cttaattgcacttttgg-cccctatcttttcaaaagttgcg |
35173085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 37343655 - 37343707
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| || ||| ||||| |
|
|
| T |
37343655 |
ttaattgcacttttgcccccttatcttttcaaaagttgcgattttggtcccct |
37343707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 5908 - 5851
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5908 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 5590 - 5647
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
5590 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
5647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 50; Significance: 8e-20; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 10943 - 10886
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10943 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 16233 - 16176
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16233 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 10627 - 10683
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10627 |
aggcttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
10683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 15917 - 15973
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15917 |
aggcttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
15973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 50; Significance: 8e-20; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 20593 - 20650
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20593 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
20650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 12050 - 12102
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12050 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
12102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 20928 - 20874
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggaccc |
208 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
20928 |
aggcttatttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
20874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 29648 - 29705
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29648 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 29974 - 29909
Alignment:
| Q |
145 |
attaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29974 |
attaaatcaaggcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
29909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 401021 - 400964
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
401021 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
400964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 400703 - 400754
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgga |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
400703 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
400754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 147 - 91
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
147 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
91 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 6867 - 6923
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6867 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 1187 - 1239
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1187 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 1494 - 1442
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
1494 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
1442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 49; Significance: 3e-19; HSPs: 4)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 10875 - 10819
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10875 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
10819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 20866 - 20915
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttat |
202 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
20866 |
aaggcttaattgcacttttggacctctatcttttcaaaagttgcggttat |
20915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 10557 - 10611
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| | |||||||| |
|
|
| T |
10557 |
aaggcttaattgcacttttggacccctatcttttccaaagttgcagctatggacc |
10611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 21164 - 21107
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
21164 |
aaggcttaattgcatttttggacccctatctttccaaaagttgcggtaatggccccct |
21107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 81616 - 81560
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
81616 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
81560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 81306 - 81360
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
81306 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
81360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 238621 - 238677
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
238621 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
238677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 238938 - 238882
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
238938 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
238882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 7719 - 7773
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
7719 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
7773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 8033 - 7979
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8033 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 144 - 210
Target Start/End: Original strand, 9936 - 10002
Alignment:
| Q |
144 |
aattaaatgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||| | |||||||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
9936 |
aattaacttaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 10252 - 10195
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
10252 |
aaggcttaattgcatttttggacccctatctttctaaaagttgcggttatggatccct |
10195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 26264 - 26318
Alignment:
| Q |
156 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
26264 |
gcttaattgcacttttgaactcctatcttttcaaaagttgcggttatggccccct |
26318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 26555 - 26511
Alignment:
| Q |
160 |
aattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
||||||||||||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
26555 |
aattgcacttttggacctctatctttccaaaagttgcggttatgg |
26511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 20941 - 20884
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20941 |
aaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
20884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 20622 - 20681
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccct----atcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20622 |
ggcttaattgcacttttggacccctccctatcttttcaaaagttgcggttatggacccct |
20681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 184 - 128
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
184 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 139484 - 139432
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
139484 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
139432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 139173 - 139230
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||| |||||||||||||||||||||||| |
|
|
| T |
139173 |
aaggtttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
139230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 818 - 873
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
818 |
aggcttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccc |
873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 16067 - 16012
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16067 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
16012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 21360 - 21305
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
21360 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
21305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 21066 - 21121
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||| ||||| |||||| ||||| |
|
|
| T |
21066 |
ggcttaattgcacttttggatccctatctttccaaaatttgcgattatggccccct |
21121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 22295 - 22350
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
22295 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
22350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 22589 - 22534
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
22589 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
22534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2010 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold2010
Description:
Target: scaffold2010; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 491 - 548
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
491 |
aaggcttaattgcacttttgaccccctatcttttcaaaagttgcgattttggccccct |
548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 1353 - 1410
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |||| ||||| |
|
|
| T |
1353 |
aaggcttaattgcacttttggatccctatcttttcaaaagttgcggtcatggccccct |
1410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 1650 - 1594
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
1650 |
aaggtttaattgcacttttggaccc-tatctttccaaaagttgcggttatggccccct |
1594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 3708 - 3757
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacc |
207 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
3708 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
3757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 2646 - 2699
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2646 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
2699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 2958 - 2903
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||| |||||||| |||||||||||||| |
|
|
| T |
2958 |
ggcttaattgcacttttggacccttatttttctaaaagttggggttatggacccct |
2903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 4835 - 4786
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
4835 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
4786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 4543 - 4590
Alignment:
| Q |
157 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
204 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |||||| |
|
|
| T |
4543 |
cttaattgcacttttggacccttatcttttcaaaagttgcgtttatgg |
4590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 75108 - 75165
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
75108 |
aaggcttaattgcacttttggacccctatttttccaaaagttgccgttatggacccct |
75165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 75385 - 75333
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
75385 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggatccct |
75333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 14615 - 14563
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
14615 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
14563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 201
Target Start/End: Original strand, 21836 - 21884
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggtta |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
21836 |
aaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
21884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 762 - 818
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||| |||| |||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
762 |
aggcttaattgcatttttagacccctatctttccaaaagttgcggttacggacccct |
818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 9024 - 8975
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
9024 |
aggcttaattgcatttttggacccctatctttccaaaagttgtggttatg |
8975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 63378 - 63322
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||| || ||| ||||| |
|
|
| T |
63378 |
aaggcttaattgcacttttga-cccctattttttcaaaagttgcgattttggtcccct |
63322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 3781 - 3837
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
3781 |
aaggcctaattgcacttttggaccc-tatctttccaaaagttgcggttatggaaccct |
3837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 122645 - 122601
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
122645 |
aaggcttaattgcacttttggccccctatctttccaaaagttgcg |
122601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1301 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1301
Description:
Target: scaffold1301; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 210
Target Start/End: Complemental strand, 1365 - 1306
Alignment:
| Q |
151 |
tgaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||||||||||| || ||| ||||| |
|
|
| T |
1365 |
tgaaggcttaattgcacttttggccccttatctttccaaaagttgcgattttggccccct |
1306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0279 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0279
Description:
Target: scaffold0279; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 7229 - 7186
Alignment:
| Q |
154 |
aggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7229 |
aggcttaattgcacttttggccccatatcttttcaaaagttgcg |
7186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Complemental strand, 23161 - 23119
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcg |
197 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23161 |
ggcttaattgcacttttggtcctctatcttttcaaaagttgcg |
23119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 16522 - 16567
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
203 |
Q |
| |
|
|||||||| |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
16522 |
ttaattgctcttttggattcctatcttttcaaaagttgcggttatg |
16567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 210
Target Start/End: Complemental strand, 47844 - 47796
Alignment:
| Q |
162 |
ttgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| || ||| ||||| |
|
|
| T |
47844 |
ttgcacttttgaccccttatcttttcaaaagttgcgattttggccccct |
47796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 155 - 196
Target Start/End: Original strand, 31979 - 32020
Alignment:
| Q |
155 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgc |
196 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
31979 |
ggcttaattgcacttttggccccctatctttccaaaagttgc |
32020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 32325 - 32268
Alignment:
| Q |
153 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
32325 |
aaggcttaattgtacttttggccccctatctttccaaaagttgcgattttggccccct |
32268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 55463 - 55411
Alignment:
| Q |
158 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| || ||| ||||| |
|
|
| T |
55463 |
ttaattgcacttttggttccctatcttttcaaaagttgcgattttggccccct |
55411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University