View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6088_high_14 (Length: 240)
Name: NF6088_high_14
Description: NF6088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6088_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 32798661 - 32798864
Alignment:
| Q |
19 |
gtaaggtcaaagacatgaattgaaaagttaaattagggcatcacatgtggatgaggttgttgtctcagtctaagcttttacccacgttgtatccacattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32798661 |
gtaaggtcaaagacatgaattgaaaagttaaattagggcatcacatgtggatgaggttgttgtctcagtctaagcttttacccacgttgtatccacattt |
32798760 |
T |
 |
| Q |
119 |
tacttttcatcttcaaaaatatagctttagctacaaaaccaaggacgatatggtagggtcaccacaagtt--ggggccatttcctgtagatggtattatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32798761 |
tacttttcatcttcaaaaatatagctttagctacaaaaccaaggacgatatggtagggtcaccacaagttggggggccatttcctgtagatggtattatt |
32798860 |
T |
 |
| Q |
217 |
atga |
220 |
Q |
| |
|
|||| |
|
|
| T |
32798861 |
atga |
32798864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University