View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6088_low_13 (Length: 257)
Name: NF6088_low_13
Description: NF6088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6088_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 24338328 - 24338552
Alignment:
| Q |
18 |
ctaaggagtgaaagattggctaacttggttggatgttgcatcgatggagacgagagattgcttgttgctgagttcatgccaaatgaaactctctctaaac |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24338328 |
ctaaggagtgaaagattagctaacttggttggatgttgcatagatggagacgagagattgcttgttgctgagttcatgccaaatgaaactctctctaaac |
24338427 |
T |
|
| Q |
118 |
atctttttcattgtaagttttcatttatcttgtttatccaactataattttttaattttgaagttgtgtatgtttggttccacttttggagtagtcaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24338428 |
atctttttcattgtaagttttcatttatcttgtttatccaaccataa-tttttaattttgaagttgtgtatgtttggttccacttttggagtagtcaaaa |
24338526 |
T |
|
| Q |
218 |
ctttattttagaggtgttggattgat |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
24338527 |
ctttattttagaggtgttggattgat |
24338552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 39438683 - 39438730
Alignment:
| Q |
186 |
tatgtttggttccacttttggagtagtcaaaactttattttagaggtgt |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||| ||||||| |
|
|
| T |
39438683 |
tatgtttggttccacgtttggagtagtcaaaa-ttgattttggaggtgt |
39438730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 42 - 143
Target Start/End: Original strand, 41807426 - 41807527
Alignment:
| Q |
42 |
ttggttggatgttgcatcgatggagacgagagattgcttgttgctgagttcatgccaaatgaaactctctctaaacatctttttcattgtaagttttcat |
141 |
Q |
| |
|
|||||||| |||||| || ||||| ||||||||||| ||||| ||||| ||||| ||||||||||||| ||| ||||| ||||| ||| ||||||||| |
|
|
| T |
41807426 |
ttggttggttgttgctgggaaggagaagagagattgctagttgcagagtttatgcctaatgaaactctctataagcatctctttcactgtgagttttcat |
41807525 |
T |
|
| Q |
142 |
tt |
143 |
Q |
| |
|
|| |
|
|
| T |
41807526 |
tt |
41807527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 180 - 243
Target Start/End: Complemental strand, 15478197 - 15478135
Alignment:
| Q |
180 |
gttgtgtatgtttggttccacttttggagtagtcaaaactttattttagaggtgttggattgat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| || | |||||| ||||||| ||||| | |||||| |
|
|
| T |
15478197 |
gttgtgtatgtttggttccacttttggaggag-ccaaacttgattttagcggtgtagaattgat |
15478135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 243
Target Start/End: Complemental strand, 3845305 - 3845246
Alignment:
| Q |
183 |
gtgtatgtttggttccacttttggagtagtcaaaactttattttagaggtgttggattgat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || ||| ||||||||| | |||||| |
|
|
| T |
3845305 |
gtgtatgtttggttccacttttggagtaaccaaaa-ttgattctagaggtgtagaattgat |
3845246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University