View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6088_low_16 (Length: 227)
Name: NF6088_low_16
Description: NF6088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6088_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 33346558 - 33346767
Alignment:
| Q |
1 |
tttatgtttataaattattactcatctctaatatttgtgtcggtttcattacttcataaggtattgttaatgtaccattgtttgttgagtttcagtaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33346558 |
tttatgtttataaattattactcatctctaatatttgtgtcggtgtcattacttcataaggtattgttaatgtaccattgtttgttgagtttcagtaaat |
33346657 |
T |
|
| Q |
101 |
aagatatttatttttatatcatagaattatgttaattttatattagtgtatgttcatgaataaaacacttgttatccaatttggcaccattgacttttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33346658 |
aagatatttatttttatatcatagaattatgttaattttatatttgtgtatgttcatgaataaaacacttgttatccaatttggcaccattgacttttca |
33346757 |
T |
|
| Q |
201 |
acagtttggg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
33346758 |
acagtttggg |
33346767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University