View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6088_low_17 (Length: 227)
Name: NF6088_low_17
Description: NF6088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6088_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 132 - 212
Target Start/End: Complemental strand, 18465974 - 18465894
Alignment:
| Q |
132 |
acaatctagaagtcaagattctttcttatttaacttgtatatattgccgatgtataaaaagtttacttatggatttaaaca |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18465974 |
acaatctagaaatcaagattctttcttatttaacttgtatatattgccgatgtataaaaagtttacttatggatttaaaca |
18465894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University