View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6088_low_19 (Length: 209)
Name: NF6088_low_19
Description: NF6088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6088_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 37699056 - 37699239
Alignment:
| Q |
11 |
gagatgaagcaatgtccaaacttaccaccatagtttccttgtgtggaattggaattgttttgagta-tatataactcaaatttatcgtaagagatcttat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37699056 |
gagatgaagcaatgtccaaacttaccaccatagtttccttgtgtggaattggaattgttttgagtaatatataactcaaatttatcgtaagagatcttat |
37699155 |
T |
 |
| Q |
110 |
agtgatggtggatcgataaaaagaatgatccgagagtggtggttttgcacaaaaatccaaggtggaggttatagtcgatggtag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37699156 |
agtgatggtggatcgataaaaagaatgatccgagagtggtggttttgcacaaaaatccaaggtggaggttatagtcgatggtag |
37699239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University