View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6089_high_17 (Length: 206)
Name: NF6089_high_17
Description: NF6089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6089_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 12307116 - 12306920
Alignment:
| Q |
1 |
gcgcttctctataagtttgctgcatcctctctcttcggtggtgatcttgttgcatatgcatacttatttcctcattgcctgactttttatatcttgctga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12307116 |
gcgcttctctataagtttgctgcaacctctctcttcggtggtgatcttgttgcatatgcatacttatttcctcattgcctgactttttatatcttgctga |
12307017 |
T |
|
| Q |
101 |
aatgggagtgccatttccccttgcaaatctgttcttcaaggagatatcaactttatcattaacagggttatatttatcacttgattcacaggttctg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12307016 |
aatgggagtgccatttccccttgcaaatctgttcttcaaggagatatcaactttatcattaacagggttatatttatcacttgattcactggttctg |
12306920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University