View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6089_low_1 (Length: 442)
Name: NF6089_low_1
Description: NF6089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6089_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 362
Target Start/End: Complemental strand, 2465261 - 2464924
Alignment:
| Q |
19 |
acagaggcataacatgatcttaaaaacatgaaaatggggttagttctgcttgtggacggcagctctaactaaaatgccgcatctccaatggatggtttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||| ||||||||| ||||||||||||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
2465261 |
acagaggcataacatgatcttaaaaacatgaaaatgagcttaattctgcttgaggacggcagctctaactccaatgccacatctccaatgggtggtttaa |
2465162 |
T |
|
| Q |
119 |
acttgaagatatcattgtagcagagcaagcttgttagttgtgtccagacctggcgacagcctttatttgagtggtagtgttttagtgccactctagagtg |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
2465161 |
acttgaagatatcattgtagcagggcaagcttgttagttgtgtccagacctggcgacagcctttatttgagtg-----gttttagtggcactctggagtg |
2465067 |
T |
|
| Q |
219 |
taaaaattttctccattgatttcttctgttataaacacaacatctcaaacatcgttaaatgccctttttcacaatctttgtttattcttagtctgggcgt |
318 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
2465066 |
taaaaaatttctccattgatttcttctgttataaacacaacatctcaaacatcgttaaatgccc-ttttcacagtctttgtttattcttagtctgggcgt |
2464968 |
T |
|
| Q |
319 |
ggtatgtagtggacttccctagtttcataccacttcagcataac |
362 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2464967 |
ggtatgtggtggacttccctagtttcataccacttcagcataac |
2464924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 370 - 432
Target Start/End: Complemental strand, 2463283 - 2463221
Alignment:
| Q |
370 |
tggtatggttcaagatttgaggccaacattataaattttttgaaccaatgaatttgagaatta |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2463283 |
tggtatggttcaagatttgaggccaacattataaattttttgaaccaatgaatttgagaatta |
2463221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University