View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6089_low_10 (Length: 241)
Name: NF6089_low_10
Description: NF6089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6089_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 41 - 180
Target Start/End: Complemental strand, 42695860 - 42695722
Alignment:
| Q |
41 |
tgtttagaagtcaaacccaaataattggtgtgtagtatgttggcgtgttgaaaactttagagtattacattactttcctattcataaaaaagtttaatat |
140 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42695860 |
tgtttagaagtcaaacccaaatagttggtgtgtagtatgttg-cgtgttgaaaactttagagtattacattactttcctattcataaaaaggtttaatat |
42695762 |
T |
 |
| Q |
141 |
tagtaatttgtcttaaaaatgatattgatatattatgagg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42695761 |
tagtaatttgtcttaaaaatgatattgatatattatgagg |
42695722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University