View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6089_low_2 (Length: 411)
Name: NF6089_low_2
Description: NF6089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6089_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 17 - 392
Target Start/End: Original strand, 12307068 - 12307443
Alignment:
| Q |
17 |
caagatcaccaccgaagagagaggttgcagcaaacttatagagaagcgccttccattgagattgggccaaagcgactcaaagtccgaggcccttcatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12307068 |
caagatcaccaccgaagagagaggttgcagcaaacttatagagaagcgccttccattgagattgggccaaagcgactcaaagtccgaggcccttcatttt |
12307167 |
T |
|
| Q |
117 |
tgggcatagagagcagattgaattgaagtgtttcaagttgccttttgaaaatatttggagagtctgactttgctaacttcattttagctaatgggctttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12307168 |
tgggcatagagagcagattgaattgaagtgtttcaagttgccttttgaaaatatttggagagtctgactttgctaacttcattttagctaatgggctttc |
12307267 |
T |
|
| Q |
217 |
taacaatacagaaaatccaaatgattgattcaggaagcagccgcaaggtattaaccaattaggatatgaatttacattctttgtgcaggcaagccctaac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12307268 |
taacaatacagaaaatccaaatgattgattcaggaagcagccgcaaggtattaaccaattaggatatgaatttacattctttgtgcaggcaagccctaac |
12307367 |
T |
|
| Q |
317 |
atttgggcagtctgcacgggtggtgatccttgggttctctggccggggtgtttttcctacttcgctgggtgaacct |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12307368 |
atttgggcagtctgcacgggtggtgatccttgggttctctggccggggtgtttttcctacttcgctgggtgaacct |
12307443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University