View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6090_low_4 (Length: 240)
Name: NF6090_low_4
Description: NF6090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6090_low_4 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 68 - 240
Target Start/End: Original strand, 32874508 - 32874680
Alignment:
| Q |
68 |
gtgtaggttgcctccattttacaaatttcttggcaccactatctggtagatattacgtggttctcccagaaacgctcaaaatttcttgtgatttcagaca |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874508 |
gtgtaggttgcctccattttacaaatttcttgacaccactatctggtagatattacgtcgttctcccagaaacgctcaaaatttcttgtgatttcagaca |
32874607 |
T |
 |
| Q |
168 |
ctgctagctcaactttctgctagaagttgttttggttcttcaactgacactagccacaaacatggtcaattat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874608 |
ctgctagctcaactttctgctagaagttgttttggttcttcaactgacactagccacaaacatggtcaattat |
32874680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 32874441 - 32874478
Alignment:
| Q |
1 |
tgaataggttcaatcatatacaataataaagtaaaata |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874441 |
tgaataggttcaatcatatacaataataaagtaaaata |
32874478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University