View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6091_low_4 (Length: 243)
Name: NF6091_low_4
Description: NF6091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6091_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 35423894 - 35423683
Alignment:
| Q |
20 |
gttgcattgcatacacagcttcaatcaatcaaggttggaatgaagactacaatggcttcaccttctctctccaaattctgctctttaacacccactcttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35423894 |
gttgcattgcatacacagcttcaatcaatcaaggttggaatgaagactacaatggcttcaccttctctctccaaattctgctctttaacacccactcttt |
35423795 |
T |
 |
| Q |
120 |
cccaacatcacacccaatcattcccttccacaacttcactcagattcctccatactaccacttctaccaatttcaataccatttttcttcaca---aacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35423794 |
cccaacatcacacccaatcattcccttccacaacttcactcagattcccccatactaccacttctaccaatttcaataccatttttcttcacaaacaacc |
35423695 |
T |
 |
| Q |
217 |
tctctctctgtg |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35423694 |
tctctctctgtg |
35423683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University