View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6091_low_5 (Length: 210)
Name: NF6091_low_5
Description: NF6091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6091_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 23878691 - 23878869
Alignment:
| Q |
20 |
gttagcagtttcacggaatgttaatgctcagctacatattcttgatagttcggcagaacctaatgagcttgaggatttccaaaatcgatatcatgttgga |
119 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23878691 |
gttagcagtttcacgaaatgttaaagctcagctacatattcttgatagttctactgaacctaacgagcttgaggatttccaaaatcgatatcatgttgga |
23878790 |
T |
 |
| Q |
120 |
aaacctgtttctggtcatgttttgagtatcaacgacttggagaagaagctcctgcggttggttttgcgcccctatgctactc |
201 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
23878791 |
aaacctgtttctggtcatgttctgagtatca---acttggagaagaagctcttgcggttggttttgcgccccttttctactc |
23878869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University