View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6092_low_8 (Length: 315)
Name: NF6092_low_8
Description: NF6092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6092_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 162 - 299
Target Start/End: Complemental strand, 36774866 - 36774729
Alignment:
| Q |
162 |
ctcatgagtgtccaaattatttgaaatttttgtatatattatcaatgatcaacacgacaacataatgtgattcaacgattgggttgattaaatttgcatt |
261 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774866 |
ctcatgggtgtccaaattatttgaaatttttgtatatattatcaatgatcaacacgacaacataatgtgattcaacgattgggttgattaaatttgcatt |
36774767 |
T |
 |
| Q |
262 |
tttcaaaaggtaattgaagatataagtatgtcaatttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774766 |
tttcaaaaggtaattgaagatataagtatgtcaatttt |
36774729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 17 - 106
Target Start/End: Complemental strand, 36775011 - 36774922
Alignment:
| Q |
17 |
atgaatttaagaaaatgaattgaaagttattatttgaatcaagtctacaaaattttataaaatttgaaagttatttgatttaggcataac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36775011 |
atgaatttaagaaaatgaattgaaagttattatttgaatcaagtctacaaaattttataaaatttgaaagttatttgatttaggcataac |
36774922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University