View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6094_high_19 (Length: 209)
Name: NF6094_high_19
Description: NF6094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6094_high_19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 4 - 209
Target Start/End: Complemental strand, 28136894 - 28136686
Alignment:
| Q |
4 |
ttttttgtgattaaatcaagtattagttgattgaattggaatttatatgtttgttttagtttttaggttgaaatcaatttgaaatttgaatcataaatgt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28136894 |
ttttttgtgattaaatcaagtattagttgattgaattggaatttatatgtttgttttagtttttaggttgaaatcaatttgaaatttgaattataaatgt |
28136795 |
T |
|
| Q |
104 |
gttattggattgttgagtgagtgtgagtgaagagtagtagatcgaaggcgtgtctcgtatccgacaagcat---tgtctgacatgtgattacattgaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28136794 |
gttattggattgttgagtgagtgtgagtgaagagtagtagatcgaaggcgtgtctagtatccgacaagcattagtgtctgacatgtgattacattgaaat |
28136695 |
T |
|
| Q |
201 |
atgttattt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
28136694 |
atgttattt |
28136686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University