View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6094_high_20 (Length: 204)

Name: NF6094_high_20
Description: NF6094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6094_high_20
NF6094_high_20
[»] chr1 (1 HSPs)
chr1 (47-114)||(50529617-50529684)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 47 - 114
Target Start/End: Original strand, 50529617 - 50529684
Alignment:
47 tgagctccattgtaaatgatgaactcatggcaccggcacctctgatcaaggtgtgtccgatgtctgag 114  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||    
50529617 tgagctccattgtaaatgatgaactcatagcaccggcacctctgatcaaagtgtgtccgatgtctgag 50529684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University