View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6094_high_9 (Length: 281)
Name: NF6094_high_9
Description: NF6094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6094_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 14697802 - 14698048
Alignment:
| Q |
19 |
aaatcggtgcatacctttgcactttatagttttctcaggttcatgtacatagcaaaagtttcagtgagtcaaagacaccaaggccttcctattgtgaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14697802 |
aaatcggtgcatacctttgcactttatagttttctcaggttcatgtacatagcaaaagtttcagtgagtcaaagacaccaaggcattcctattgtgaaat |
14697901 |
T |
 |
| Q |
119 |
aacagattggaattgaggtgtatatatggtaacatatattgaaagaagacaaattttatttcttttagaacatatgagcaaaatttgccatcttaggata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||| ||||| |
|
|
| T |
14697902 |
aacagattggaattgaggtgtatatatggtaatatatattgaaagaagacaaattttatttcttttagagc--atgagcaaaatttgctatctttggata |
14697999 |
T |
 |
| Q |
219 |
gaatgatgccaccatgccatctgcgaaaaagcttcttatatttccctttg |
268 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14698000 |
gaatgatgctaccatg-tatctgcgaaaaagcttcttatatttccctttg |
14698048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University