View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6094_low_17 (Length: 219)
Name: NF6094_low_17
Description: NF6094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6094_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 20 - 201
Target Start/End: Complemental strand, 7263427 - 7263246
Alignment:
| Q |
20 |
atgaaactgcttataaatgagttggcatatttagtgcatgtttgtatatatgaacacacagctagtgaatcatgagttggcaatataaaccgataaagaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7263427 |
atgaaactgcttataaatgagttggcatatttagtgcatgtttgtatatatgaacacacagctagtgaatcatgagttggcaatataaaccgataaagaa |
7263328 |
T |
|
| Q |
120 |
ttataattggtgtccactgtgaattaatgcgtttgattgtagagattgaaatgaggactacttgctcctcttgtcccaaaca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7263327 |
ttataattggtgtccactgtgaattaatgcgtttgattgtagagattgaaatgaggactacttgctcctcttgtcccaaaca |
7263246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University