View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6096_high_5 (Length: 347)
Name: NF6096_high_5
Description: NF6096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6096_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 35517338 - 35517668
Alignment:
| Q |
1 |
aatgattagatacagaagccaagtgtctcaaagtatcaaacaattctctagcagcagaaagtgttcttcgaacggtgcaaagctctggaacggtcaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35517338 |
aatgattagatacagaagccaagtgtctcaaagtatcaaacaattctctagcagaagaaagtgttcttcgaacggtgcaaagctctggaacggtcaacaa |
35517437 |
T |
 |
| Q |
101 |
tttaccagaaacggcaacggagagaatgccagtcaagtcatgtattccagaaaagtcgagttgttgttgagggacgagtctggcagcggaggtttgatcg |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35517438 |
tttaccagaaacggaaacggagagaatgtcagtcaagtcatgtattccagaaaagtcgagttgttgttgagggacgagtctggcagcggaggtttgatcg |
35517537 |
T |
 |
| Q |
201 |
agaagcttttggctgtggtgtggagtaagtccgacgggtaaacgggcgttgttggcggcggaggagcccattgaagtggaagtgaatgtagagagttgct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35517538 |
agaagcttttggctgtggtgtggagtaagtccgacgggtaaacgggcgttgttggcggcggaggagcccattgaagtggaagtgaatgcagagagttgct |
35517637 |
T |
 |
| Q |
301 |
tgcatatggagttccattcaagagttttgag |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35517638 |
tgcatatggagttccattcaagagttttgag |
35517668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University