View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6096_low_14 (Length: 229)
Name: NF6096_low_14
Description: NF6096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6096_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 12 - 213
Target Start/End: Complemental strand, 30995356 - 30995154
Alignment:
| Q |
12 |
caattaaaagatgatagctaaattatgtgttctaagtctttctcaacggttttcgaggtttggatgatgcagattcttt-agggggatgatggaggaggg |
110 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
30995356 |
caattaaaagatgatagttaaattatgtgttctaagtctttctcaacggttttcgtggtttggatgatgcagattcttggaggtggatgatggaggaggg |
30995257 |
T |
|
| Q |
111 |
tggtattttttcggtaaagtcttgctatattttacttgagaggttttgcttattagatggtggtgtgagccttgcagagcagattgtatttgggcgcctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995256 |
tggtattttttcggtaaagtcttgctatattttacttgagaggttttgcttattagatggtggtgtgagccttgcagagcagattgtatttgggcgcctt |
30995157 |
T |
|
| Q |
211 |
tga |
213 |
Q |
| |
|
||| |
|
|
| T |
30995156 |
tga |
30995154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 38705939 - 38705881
Alignment:
| Q |
121 |
tcggtaaagtcttgctatattttacttgagaggttttgcttattagatggtggtgtgag |
179 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| || || ||| |||| ||||||||||| |
|
|
| T |
38705939 |
tcggtaaagtcttgttataatttacttgagagcttgtgtttactagagggtggtgtgag |
38705881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University