View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6098_low_2 (Length: 266)
Name: NF6098_low_2
Description: NF6098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6098_low_2 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 266
Target Start/End: Original strand, 38793054 - 38793305
Alignment:
| Q |
15 |
ctattggcactacgatcctgcttgagatagtacaaatcattggattcagccggaaagatctcatcgcgggtccgtgtagtgttgagatttgtatactttt |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38793054 |
ctattggcactacgaccctgcttgagatagtacaaatcattggattttgccggaaagatctcatcgcgggtccgtgtagtgttgagatttgtatactttt |
38793153 |
T |
 |
| Q |
115 |
gttcaagtgattcctcgggtatgttccttgctaacaaaggtgatgcacctccccaattatttgtgcctaaagatgggtgttgaggtgttctaaattccaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38793154 |
gttcaagtgattcctcgggtatgttccttgctaacaaaggtgatgcacctccccaattatttgtgcctaaagatgggtgttgaggtgttctaaattccaa |
38793253 |
T |
 |
| Q |
215 |
cattacttctctttgtctttgcttcatttttgaagtgtcctccattttattc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38793254 |
cattacttctctttgtctttgcttcatttttgaagtgtcctccattttattc |
38793305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University