View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6099_high_29 (Length: 239)
Name: NF6099_high_29
Description: NF6099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6099_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46046971 - 46046749
Alignment:
| Q |
1 |
tctggccactctcctctttctttttctctcagggtcattccaccatgacatactcttcttctttttcaccacagaacgtttttgcagcgtcttataattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||| ||||||| |
|
|
| T |
46046971 |
tctggccactctcctctttctttttctctcagggtcattccaccatgacatgctcttcttctttttcaccacagaacgttctcgcagcgtctcataattt |
46046872 |
T |
|
| Q |
101 |
ttcaccacagaacgttctcgcgatgtctcataataattataattagagtacagagatggagagttcatgctcctcccaacccacaatttggtgttgccga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
46046871 |
ttcaccacagaacgttctcgcgatgtctcataataattataattagagtacagagatggagagttaacgctcctcccaacccacaatttggtgttgccga |
46046772 |
T |
|
| Q |
201 |
tgcttctcacatttgcatcatgt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46046771 |
tgcttctcacatttgcatcatgt |
46046749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University