View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6099_high_5 (Length: 479)
Name: NF6099_high_5
Description: NF6099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6099_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 5e-88; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 5e-88
Query Start/End: Original strand, 113 - 301
Target Start/End: Complemental strand, 19400537 - 19400350
Alignment:
| Q |
113 |
aaaagagagattccaccgccaaactccactttcgtcgttaccgacgaactccatcgaggctgtaacaaaatcatcatttccgcgttggaacaccattttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
19400537 |
aaaagagagattccaccgccaaactccactttcgtcgttaccgacgaactccatcgaggctgtaacaaaatcatcatttccgtgttggaactccattttt |
19400438 |
T |
 |
| Q |
213 |
ggattcatcggttacatatcttcatcatctctctccaaaccgatatgcaaccgaggaaccttgaagtatcgttccctcaatcattatat |
301 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19400437 |
ggattcatcggtt-catatcttcatcatctctctccaaaccgatatgcaactgaggaaccttgaagtattgttccctcaatcattatat |
19400350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 404 - 465
Target Start/End: Complemental strand, 19396151 - 19396090
Alignment:
| Q |
404 |
ctaatgggatgacattaatgatagttgtaaagctatcagccacagagtcaatgtgcatatgt |
465 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
19396151 |
ctaatgggatgacattaatgatagttgtgaagctatcagccacagagtcaatgtgcttatgt |
19396090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 10 - 65
Target Start/End: Complemental strand, 19400641 - 19400586
Alignment:
| Q |
10 |
gcaaaggagtagtttaactatcaatagtatttannnnnnnaatactctttcttcag |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19400641 |
gcaaaggagtagtttaactatcaatagtatttatttttttaatactctttcttcag |
19400586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 216 - 282
Target Start/End: Complemental strand, 2469670 - 2469604
Alignment:
| Q |
216 |
ttcatcggttacatatcttcatcatctctctccaaaccgatatgcaaccgaggaaccttgaagtatc |
282 |
Q |
| |
|
|||||| |||| | |||||| ||||||||||||||| ||| | ||||| ||||||||||||||||| |
|
|
| T |
2469670 |
ttcatcagttatagatcttcctcatctctctccaaatcgaatttcaaccaaggaaccttgaagtatc |
2469604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University