View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6099_low_16 (Length: 320)
Name: NF6099_low_16
Description: NF6099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6099_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 12 - 303
Target Start/End: Complemental strand, 42839092 - 42838801
Alignment:
| Q |
12 |
atgaaaggtcaaaatactgcttttttccttcagctttataaaggaacgttccctacatcattgcagaggtagttgtttgagcagcaacactagagtctag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42839092 |
atgaaaggtcaaaatactgcttttttccttcagctttataaaggaacgttccctacatcattgcagaggtagttgtttgagcagcaacactagagtctag |
42838993 |
T |
|
| Q |
112 |
ctccatagcagaagctctggaaggtgatgctggctgcacctccacatctggataagctgccttaaaccttgctctcagcccttcatccactaaccttaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42838992 |
ctccatagcagaagctctggaaggtgatgctggctgcacctccacatctggataagctgccttaaaccttgctctcagcccttcatccactaaccttaca |
42838893 |
T |
|
| Q |
212 |
ccactcaattgattaccaagagacatccaccctgcatgagtattgtgcatgcgagcaaacaactccacctttcttgttccgggacttatcct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42838892 |
ccactcaattgattaccaagagacatccaccctgcatgagtattgtgcatgcgagcaaacaactccacctttcttgttccgggacttatcct |
42838801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 84 - 242
Target Start/End: Original strand, 43911723 - 43911881
Alignment:
| Q |
84 |
ttgtttgagcagcaacactagagtctagctccatagcagaagctctggaaggtgatgctggctgcacctccacatctggataagctgccttaaaccttgc |
183 |
Q |
| |
|
|||||||| |||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43911723 |
ttgtttgaacagcaacactggagtctacctccatagcagaagctctgggaggtgatgctggctgcacctccacatctggataagctgccttaaaccttgc |
43911822 |
T |
|
| Q |
184 |
tctcagcccttcatccactaaccttacaccactcaattgattaccaagagacatccacc |
242 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43911823 |
ccgcagcccttcatccactaaccttacaccactcaattgattacccagagacatccacc |
43911881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 240 - 300
Target Start/End: Original strand, 43912154 - 43912214
Alignment:
| Q |
240 |
accctgcatgagtattgtgcatgcgagcaaacaactccacctttcttgttccgggacttat |
300 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
43912154 |
accccgcatgagtattgtgcatgcgagcaaacaactccagctttcttgttcttggacttat |
43912214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 84 - 174
Target Start/End: Original strand, 8633832 - 8633922
Alignment:
| Q |
84 |
ttgtttgagcagcaacactagagtctagctccatagcagaagctctggaaggtgatgctggctgcacctccacatctggataagctgcctt |
174 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8633832 |
ttgtttgagcagcaacactagagtctacttccatagaagaagctctaagaggtgatgctggctgcacctccacatctaaataagctgcctt |
8633922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University