View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6099_low_22 (Length: 279)
Name: NF6099_low_22
Description: NF6099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6099_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 261
Target Start/End: Original strand, 38229785 - 38230037
Alignment:
| Q |
9 |
tcaaacccttcgattctaaattcaaattcatcaactaatcaaacccnnnnnnnctcaaaggtgcgaataaatactcatggtgagtggcttgtggtaaatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38229785 |
tcaaacccttcgattctaaattcaaattcatcaactaatcaaacccaaaaaaactcaaaggtgcgaataaatactcatggtgagtggcttgtggtaaatc |
38229884 |
T |
|
| Q |
109 |
gtaaaaagaagaaaactccaccaattacagtgaagaaaaaatagatgggacaattaattagaaattcaaaaaacttgggtgcattcaagttgcaattaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38229885 |
gtaaaaagaagaaaactccaccaattacagtgaagaaaaaatagatgggacaattaattagaaactcaaaaaacttgggtgcattcaagttgcaattaaa |
38229984 |
T |
|
| Q |
209 |
ggaggaattaagtcaaatgataattatgaagaaggaagggataaggcgcaaat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38229985 |
ggaggaattaagtcaaatgataattatgaagaaggaagggataaggcgcaaat |
38230037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University