View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6099_low_26 (Length: 252)
Name: NF6099_low_26
Description: NF6099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6099_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 43192945 - 43193169
Alignment:
| Q |
17 |
atatccaacggttattaataaagtggtttttgggttactttcaatatagtctttgtgtcacatcagttcaaaatatttgtcatctcattagttaatagaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43192945 |
atatccaacggttattaataaagtggtttttgggttactttcaatttagtctttgtgtcacatcagttcaaaatatttgtcatctcattagttaatagaa |
43193044 |
T |
|
| Q |
117 |
gtttacaacgtcaaggtctaaactggtaacaaatgttaacattcaaagactattttgaatttaatctcgagtcaagaccattgtaacaaccagatgcaag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193045 |
gtttacaacgtcaaggtctaaactggtaataaatgttaacattcaaagactattttgaatttaatctcgagtcaagaccattgtaacaaccagatgcaag |
43193144 |
T |
|
| Q |
217 |
ctagggacgagagttacaccttacc |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43193145 |
ctagggacgagagttacaccttacc |
43193169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 111
Target Start/End: Complemental strand, 46514138 - 46514106
Alignment:
| Q |
79 |
tcagttcaaaatatttgtcatctcattagttaa |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
46514138 |
tcagtttaaaatatttgtcatctcattagttaa |
46514106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University