View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6099_low_28 (Length: 251)
Name: NF6099_low_28
Description: NF6099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6099_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 181
Target Start/End: Complemental strand, 23363365 - 23363202
Alignment:
| Q |
18 |
gtattgtaaaatgaaatttccagacacgtcttcgtcgtggtttagtaagatcaatgatcttgagaagtgtaggacgtgttcggcctatgcaaatttggat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23363365 |
gtattgtaaaatgaaatttccagacacgtcttcatcatggtttagtaagatcatggatcttgaggagtgtaggacgtgttcggcctatgcaaatttggat |
23363266 |
T |
|
| Q |
118 |
atctgtggtagaggaagcggatgtctgctctgatttgatgaactggttgacgtaagaaagttct |
181 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23363265 |
atctgtggtagaggaagcggttgtctgctctgatttgatgaactggttgacgtaagaaagttct |
23363202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 25 - 181
Target Start/End: Original strand, 23348416 - 23348575
Alignment:
| Q |
25 |
aaaatgaaatttccagacacg---tcttcgtcgtggtttagtaagatcaatgatcttgagaagtgtaggacgtgttcggcctatgcaaatttggatatct |
121 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23348416 |
aaaatgaaatttccagacacgaagtcttcatcgtggtttagtaagatcatggatcttgaggagtgtaggacatgttcggcctatgcaaatttggatatct |
23348515 |
T |
|
| Q |
122 |
gtggtagaggaagcggatgtctgctctgatttgatgaactggttgacgtaagaaagttct |
181 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23348516 |
gtggtagaggaagcggttgtctgctctgatttgatgaactggtcgacgtaagaaagttct |
23348575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University