View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6099_low_35 (Length: 238)
Name: NF6099_low_35
Description: NF6099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6099_low_35 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 40392581 - 40392344
Alignment:
| Q |
1 |
caacaaccaagccttatcccactagtcagctacatgaatcgaaccaagccttgtcccaaagatgcccggtatttttaccctgcctaaaataacccgtcac |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40392581 |
caacaaccaaaccttatcccactagtcagctacatgaatcaaaccaagccttatcccaaagatgcccggtatttttgccctgcctaaaataacccgtcac |
40392482 |
T |
|
| Q |
101 |
tcattcggactagcccgtttggcctgcataactaaaaactcaaatttagggtgagaaattgaatttctcccagaaattgaacttctgcataacaatgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40392481 |
tcattcggactagcccgtttggcctgcataactaaaaactcaaatttagggtgagaaattgaatttctcccagaaattgaacttctgcataacaatgcta |
40392382 |
T |
|
| Q |
201 |
aaaaatctaacaagtaataacaataacaatgattcgat |
238 |
Q |
| |
|
|||| || |||||||||||||||| |||||||||||| |
|
|
| T |
40392381 |
aaaactcaaacaagtaataacaatgccaatgattcgat |
40392344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University