View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6099_low_41 (Length: 209)
Name: NF6099_low_41
Description: NF6099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6099_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 16846122 - 16845939
Alignment:
| Q |
13 |
gttggtggtgatgtcgtagagaatggagtgagctgtgcagtcgagtttgagagccatgtcatgagggttgtaacggcaacggttgttggagagagagatg |
112 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16846122 |
gttggtggtgatgtcgtagaggatggagtgagcggtgcagtcgagtttgagagccatgtcgtgagggttgtaacggcaacggttgttggagagggagatg |
16846023 |
T |
|
| Q |
113 |
ttggagggaccgaaatcggttcggtcgaagatgattactttgttgtctttcattacttgcatgtgcatggctgagatgcctatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16846022 |
ttggagggaccgaaatcggttcggtcgaagatgattactttgttgtctttcattacttgcatgtgcatggctgagatgcctatg |
16845939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University