View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6101_high_12 (Length: 288)
Name: NF6101_high_12
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6101_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 40248351 - 40248098
Alignment:
| Q |
16 |
atgaaggatcaattgatagaaaaattatacttactgatttaaagcgaacacattcgtgtgaagaggaattagggtacagaaacgattcggcggtaaaagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40248351 |
atgaaggatcaattgatagaaaaattatacttactgatttaaagcgaacacattcgtgtgaagaggaattagggtacagaaacgattcggcggtaaaagg |
40248252 |
T |
 |
| Q |
116 |
attcttcgaacgctacggtggtggttgcggaagcgggaaaaagtggtggcgagacggttatggaattgcgaagcgaagaaaacggtgcgatttgcagaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40248251 |
attcttcgaacgctacggtggtggttgcggaagcgggaaaaagtggtggcgagacggttatggaattgcgaagcgaagaaaacggtgcgatttgcagaaa |
40248152 |
T |
 |
| Q |
216 |
tgttagaagaggagagaacgtgggttcgtgaggttacgatttacccgattcgtg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40248151 |
tgttagaagaggagagaacgtgggttcgtgaggttacgatttacccgattcgtg |
40248098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University