View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6101_high_15 (Length: 257)
Name: NF6101_high_15
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6101_high_15 |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 92 - 223
Target Start/End: Complemental strand, 21185143 - 21185014
Alignment:
| Q |
92 |
aattcttatgactaattatacaacaatcttgaggattttattatctgtttaattgcaaagctgt-taaaagaatcacgaagcataagcaatcaatatcaa |
190 |
Q |
| |
|
||||| |||||||| || |||||||||||||||||||||||||||| |||||||||||| ||| |||| |||||| ||||||||||||||||||| || |
|
|
| T |
21185143 |
aattcatatgactacttttacaacaatcttgaggattttattatctatttaattgcaaatatgtaaaaaataatcaccaagcataagcaatcaatat-aa |
21185045 |
T |
 |
| Q |
191 |
tattatgttttatctccaaattaccatatgacg |
223 |
Q |
| |
|
||| ||||||||| |||||||| |||||||| |
|
|
| T |
21185044 |
tat--ggttttatcttcaaattactatatgacg |
21185014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 89 - 132
Target Start/End: Complemental strand, 6671228 - 6671185
Alignment:
| Q |
89 |
gataattcttatgactaattatacaacaatcttgaggattttat |
132 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6671228 |
gataattcttacgactaattatacaacaatcttgaggattttat |
6671185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 86 - 131
Target Start/End: Complemental strand, 31209915 - 31209870
Alignment:
| Q |
86 |
gtagataattcttatgactaattatacaacaatcttgaggatttta |
131 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31209915 |
gtagataactcttatgactaattctacaacaatcttgaggatttta |
31209870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 118
Target Start/End: Complemental strand, 31206477 - 31206445
Alignment:
| Q |
86 |
gtagataattcttatgactaattatacaacaat |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
31206477 |
gtagataattcttatgactaattctacaacaat |
31206445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 131
Target Start/End: Original strand, 82909 - 82937
Alignment:
| Q |
103 |
ctaattatacaacaatcttgaggatttta |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
82909 |
ctaattatacaacaatcttgaggatttta |
82937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University