View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6101_high_4 (Length: 408)
Name: NF6101_high_4
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6101_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 55 - 402
Target Start/End: Original strand, 9112184 - 9112535
Alignment:
| Q |
55 |
ttattattttcttacgaggatcaaccataatatttacacatacacacatatgtaccatatacttgaattata----tacatataatttgaattcttgata |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9112184 |
ttattattttcttacgaggatcaaccataatatatacacatacacacatatgtaccatatacttgaattatatatatacatataatttgaattcttgata |
9112283 |
T |
|
| Q |
151 |
gctgctgcagaggatgcaaactatatggcacttaccgtgaggttgcgcgcacggagtcttgccgcagccttgatagcagcaaggagatgatcctcttcca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9112284 |
gctgctgcagaggatgcaaactatatggcacttaccgtgagattgcgcgcacggagtcttgccgcagccttgatagcagcaaggagatgatcctcttcca |
9112383 |
T |
|
| Q |
251 |
caattcgcttttgcctccaaaacttggcaatttcgcgttttgtcacactctcttctgctcttggcttcgagatgattctgaattttggaagcggaggagg |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9112384 |
caattcgcttttgcctccaaaacttggcaatttcgcgttttgtcacgctctcttctgctcttggcttcgagatgattcggaattttggaagcggaggagg |
9112483 |
T |
|
| Q |
351 |
aggtggtggtgttgctgcccttgaaatagtcccttgttccttcctttgcttc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9112484 |
tggtggtggtgttgctgcccttgaaatagtcccttgttccttcctttgcttc |
9112535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University