View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6101_low_10 (Length: 326)
Name: NF6101_low_10
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6101_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 37795343 - 37795025
Alignment:
| Q |
1 |
accaacttcattgcattccaatctttatcttattgctcnnnnnnnnnncttctggtttctgaatatgattttgccatttgttctctttcaagaaggtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37795343 |
accaacttcattgcattccaatctttatcttattgctcttttgtttttcttctggtttctgaatatgattttgccatttgttctctttcaagaaggtaat |
37795244 |
T |
 |
| Q |
101 |
atattactagaaattttttaatcttgtctatcctcaccacattgataattgttctaatcatatgtttatgatttacaattgtttttgtaaatcaaattat |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37795243 |
atattactagaatttttttaatcttgtctatcctcaccacattgataattgttctaatcatatgtatatgatttacaattgtttttgtaaatcaaattat |
37795144 |
T |
 |
| Q |
201 |
taattataagtaaattatatatatcactactttcttctaatgacttattatgatggacaacaagttttaaatgttcatattgctgccccatgtccgtttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
37795143 |
taattataagtaaattatatatatcactactttcttctaatgacttattatgattgacaacaagttttaaatgttcatattgctgccccatatccgtgtt |
37795044 |
T |
 |
| Q |
301 |
gggttgtgttcctttgctt |
319 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
37795043 |
gggttgtgttccattgctt |
37795025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University