View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6101_low_11 (Length: 318)
Name: NF6101_low_11
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6101_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 13 - 306
Target Start/End: Complemental strand, 37224629 - 37224336
Alignment:
| Q |
13 |
taggacatgatggtttgtattctaaattatccnnnnnnnngtgcggttgtagggaaacatccgcagagtacagcagaaaaacatggaaattaggtagaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224629 |
taggacatgatggtttgtattctaaattatccttttttttgtgcggttgtagggaaacatccgcagagtacagcagaaaaacatggaaattaggtagaga |
37224530 |
T |
 |
| Q |
113 |
acttctcaaaggaatatcagaaagtttgggtttggaagtcaactatatagacaaaacaatgaatctagattctggtttacaaatgttggcagcaaatctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224529 |
acttctcaaaggaatatcagaaagtttgggtttggaagtcaactatatagacaaaacaatgaatctagattctggtttacaaatgttggcagcaaatctt |
37224430 |
T |
 |
| Q |
213 |
tatcctccttgtcctcaacctgagcttgcaatgggaatgcccccacattccgatcatggcctcttgaacctcctcatccagaatggagttagtg |
306 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224429 |
tatcctccttgtcctcaacctgatcttgcaatgggaatgcccccacattccgatcatggcctcttgaacctcctcatccagaatggagttagtg |
37224336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University