View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6101_low_13 (Length: 288)

Name: NF6101_low_13
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6101_low_13
NF6101_low_13
[»] chr1 (1 HSPs)
chr1 (16-269)||(40248098-40248351)


Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 40248351 - 40248098
Alignment:
16 atgaaggatcaattgatagaaaaattatacttactgatttaaagcgaacacattcgtgtgaagaggaattagggtacagaaacgattcggcggtaaaagg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40248351 atgaaggatcaattgatagaaaaattatacttactgatttaaagcgaacacattcgtgtgaagaggaattagggtacagaaacgattcggcggtaaaagg 40248252  T
116 attcttcgaacgctacggtggtggttgcggaagcgggaaaaagtggtggcgagacggttatggaattgcgaagcgaagaaaacggtgcgatttgcagaaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40248251 attcttcgaacgctacggtggtggttgcggaagcgggaaaaagtggtggcgagacggttatggaattgcgaagcgaagaaaacggtgcgatttgcagaaa 40248152  T
216 tgttagaagaggagagaacgtgggttcgtgaggttacgatttacccgattcgtg 269  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40248151 tgttagaagaggagagaacgtgggttcgtgaggttacgatttacccgattcgtg 40248098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University