View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6101_low_20 (Length: 235)
Name: NF6101_low_20
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6101_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 11696520 - 11696319
Alignment:
| Q |
18 |
catcacaagcattctttatctccccacacttaccatacatgttgatcaaactattttgcacaatgacatcaccttcaagacccatcttaaaaacatgacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696520 |
catcacaagcattctttatctccccacacttaccatacatgttgatcaaactattttgcacaatgacatcaccttcaagacccatcttaaaaacatgacc |
11696421 |
T |
 |
| Q |
118 |
atgaacttgaattccttcatcgaccacgcctaataaagaacaagcctttaaaacaaaaggataagtgaatttatcaggctcaacacctctttcaatcata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696420 |
atgaacttgaattccttcatcgaccacgcctaataaagaacaagcctttaaaacaaaaggataagtgaatttatcaggctcaacacctctttcaatcata |
11696321 |
T |
 |
| Q |
218 |
tc |
219 |
Q |
| |
|
|| |
|
|
| T |
11696320 |
tc |
11696319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University