View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6101_low_21 (Length: 229)
Name: NF6101_low_21
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6101_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 5806751 - 5806557
Alignment:
| Q |
18 |
gaaggtgtggaattgagaaagaaacagttactactcagtcagatcggcataccatctgctcaaagaagagtcacaaagaggaatagctgaatcatcagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
5806751 |
gaaggtgtggaattgagaaagaaacagttactactcagtcagatcggcataccatctgctcaaagaggagtcacaaagaggaatagctgaaccatcagta |
5806652 |
T |
|
| Q |
118 |
gctgggaacaacagtatttggaaggatatctggaagattcgagcaccacaaaggattaagaatttcatgtggagaatttccaaacatattcttcc |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5806651 |
gctgggaacaacggtatttggaaggatatctggaagattcgagcaccacaaaggattaagaatttcatgtggagagtttccaaacatattcttcc |
5806557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University