View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6101_low_24 (Length: 206)
Name: NF6101_low_24
Description: NF6101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6101_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 53597961 - 53597883
Alignment:
| Q |
1 |
atgaaatcccacttgctcctcctctgcttcttcatttttatcacattcaccacaaaaactctctcaaccagtcctcaac |
79 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53597961 |
atgaaatcccatttgctcctcctctgcttcttcatttttgtcacattcaccacaaaaactctctcaaccagtcctcaac |
53597883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University