View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6103_high_12 (Length: 327)
Name: NF6103_high_12
Description: NF6103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6103_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 10 - 309
Target Start/End: Original strand, 37864703 - 37865003
Alignment:
| Q |
10 |
gcagagaaagggtgaaatagttgatgcacccgtaaagtgtcttctttcacatgaaaggctttagcacgttcgacatagtctttatgcttttcaagtatcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37864703 |
gcagagaaagggtgaaatagttgatgcacccgtaaagtgtcttctttcacatgaaaggctttagcacgttcgacatagtctttatgcttttcaagtatcc |
37864802 |
T |
 |
| Q |
110 |
cgaatttcttcctcgaagacctaataatgaagnnnnnnntcaaataaaattgaagaaaa-tacagtgatggtttatgtgaagaggaaaggaaagagagtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37864803 |
cgaatttcttcctcgaagacctaataatgaagaaaaaaatcgaataaaattgaagaaaaatatagtgatggtttttgtgaagaggaaaggaaagagagtt |
37864902 |
T |
 |
| Q |
209 |
acggttgaggacgctctttgtgagcaggtctgggaacggcgtttctcagagaagacatgtcgtatcaggttttacttcgcggtgatttctacggtggagg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37864903 |
acggttgaggacgctctttgtgagcaggtctgggaacggcgtttctcagagaagacatgtcgtatcaggttttacttcacggtgatttctacggtggagg |
37865002 |
T |
 |
| Q |
309 |
a |
309 |
Q |
| |
|
| |
|
|
| T |
37865003 |
a |
37865003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University