View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6103_low_18 (Length: 287)
Name: NF6103_low_18
Description: NF6103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6103_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 279
Target Start/End: Original strand, 52512076 - 52512336
Alignment:
| Q |
19 |
agttaatagatgtaatgactgcatgttcatatccaaggatgtggtagaagacgaagacgagtaatgattcaagtttgatatatcgatgctcgggtgaatc |
118 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52512076 |
agttaatagatctaatgactgcatgttcatatccaaggatgtggtagcagacgaagacgagtaatggttcaagtttgatatatcgatgctcgggtgaatc |
52512175 |
T |
|
| Q |
119 |
tggctactaatattattgttgcctctacttggagttggaatacttgtgtctccaaagttaggataattttcagcgttataaaattctcctcctgtaaaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512176 |
tggctactaatattattgttgcctctacttggagttggaatacttgtgtctccaaagttaggataattttcagcgttataaaattctcctcctgtaaaaa |
52512275 |
T |
|
| Q |
219 |
gtgtcttgagcatgagagcattcatatccttgtgctcgtcaatattattattcttcatctc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512276 |
gtgtcttgagcatgagagcattcatatccttgtgctcgtcaatattattattcttcatctc |
52512336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University