View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6103_low_23 (Length: 251)

Name: NF6103_low_23
Description: NF6103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6103_low_23
NF6103_low_23
[»] chr8 (1 HSPs)
chr8 (13-251)||(4711524-4711762)


Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 4711524 - 4711762
Alignment:
13 cagagtttcaggaccgtctcaaacgttttaggaggatttgttccaattttgagccttgttctaattttgggaactcaaaattaatgaaaaacttatgtca 112  Q
    ||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4711524 cagagtttcaggaccgtctcaaacgttttaggagggtttgatctaattttgagccttgttctaattttgggaactcaaaattaatgaaaaacttatgtca 4711623  T
113 atcggtgaggagaaaacaaggttttggaagacaagtcgaaagtttggtaggatacaagagaaagggtgagcctattctaaaatcacgtgtgaaagggatg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4711624 atcggtgaggagaaaacaaggttttggaagacaagtcgaaagtttggtaggatacaagagaaagggtgagcctattctaaaatcacgtgtgaaagggatg 4711723  T
213 attttggatgatggtatttgaaatttttatttcaattta 251  Q
    |||||||||||||||||||||| ||||||||||||||||    
4711724 attttggatgatggtatttgaagtttttatttcaattta 4711762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University