View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6103_low_23 (Length: 251)
Name: NF6103_low_23
Description: NF6103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6103_low_23 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 4711524 - 4711762
Alignment:
| Q |
13 |
cagagtttcaggaccgtctcaaacgttttaggaggatttgttccaattttgagccttgttctaattttgggaactcaaaattaatgaaaaacttatgtca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711524 |
cagagtttcaggaccgtctcaaacgttttaggagggtttgatctaattttgagccttgttctaattttgggaactcaaaattaatgaaaaacttatgtca |
4711623 |
T |
 |
| Q |
113 |
atcggtgaggagaaaacaaggttttggaagacaagtcgaaagtttggtaggatacaagagaaagggtgagcctattctaaaatcacgtgtgaaagggatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711624 |
atcggtgaggagaaaacaaggttttggaagacaagtcgaaagtttggtaggatacaagagaaagggtgagcctattctaaaatcacgtgtgaaagggatg |
4711723 |
T |
 |
| Q |
213 |
attttggatgatggtatttgaaatttttatttcaattta |
251 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4711724 |
attttggatgatggtatttgaagtttttatttcaattta |
4711762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University