View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6104_low_3 (Length: 363)
Name: NF6104_low_3
Description: NF6104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6104_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 324
Target Start/End: Complemental strand, 36282443 - 36282130
Alignment:
| Q |
11 |
ttattctcaacaaatgatttagattgcaaactaaaactcttttttaaattaagaagaatctagaacctgagttcaattttcaaatataataatcgtatta |
110 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||| ||||||| |||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36282443 |
ttatcctcaacaattgatttagattgcaaactagaactcttctttaaactaagaagaatctggaacttgagttcaattttcaaatataataatcgtatta |
36282344 |
T |
 |
| Q |
111 |
ggataggagggagtaaagcgtcaatgtggtggaaggatttgtgtgattggtgcaggggagtcgggtggtgaggaaagttggtttaaagaagggattagtt |
210 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
36282343 |
ggagaggagggagtaaagcgtcaatgtggtggaaggatttgtgtgcttggtgaaggggagtcaagtggtgagggaaattggtttaaagaagggattagtt |
36282244 |
T |
 |
| Q |
211 |
gcaatttggatgacgaagagactactttattctagaatgatccttgattggagggagggtgtttatgatgtaggtttagatgactatttgagctctgtgt |
310 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
36282243 |
gcaatttggatgacgaagaaactactttattctagaatgatccttgattggagggagggtgtttatggtgtaggtttacatgactatttgagctttgtgt |
36282144 |
T |
 |
| Q |
311 |
tgaaaggagtgtta |
324 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
36282143 |
tgaaagcagtgtta |
36282130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University