View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6106_high_14 (Length: 216)
Name: NF6106_high_14
Description: NF6106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6106_high_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 31607299 - 31607084
Alignment:
| Q |
1 |
tgtggacatgtaagcttagaaagaagttttcagaattatatctcgcaactattgaatgtgtcgttttgtgtgagctttacctgcacccggagtaatgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
31607299 |
tgtggacatgtaagcttagaaagaagttttcagaattatatctcgcaactactgaatgtgtcgttttgtgtgagctttacctgcacccggtgtgatgcaa |
31607200 |
T |
 |
| Q |
101 |
acgagaccagtcatcattccttggacagaacctatcaatgagcccttcttgtatacagccatatctagagaaatccaaacaagtatgcttgtagcagtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607199 |
acgagaccagtcatcattccttggacagaacctatcaatgagcctttcttgtatacagccatatctagagaaatccaaacaagtatgcttgtagcagtgc |
31607100 |
T |
 |
| Q |
201 |
acatatgagtattgaa |
216 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
31607099 |
acaaatgagtattgaa |
31607084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University