View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6106_low_14 (Length: 217)
Name: NF6106_low_14
Description: NF6106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6106_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 3641902 - 3641708
Alignment:
| Q |
18 |
gtaacatcagtgaaaatatatga---agtttgatccggtgacatcgtgaatttgattcttgcaacaacacgttggccaaattttgacttcatttataact |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3641902 |
gtaacatcagtgaaaatatatgatgaagtttgatccggtgacatcgtgaatttgattcttgtaacaacatgttggccaaattttgacttcatttataact |
3641803 |
T |
|
| Q |
115 |
tttga---------tacgatcctttctctctgtaaacactatatggttagtctcttaaaattcattcagagtctgctgaattcagcaactgccct |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641802 |
tttgaaccttttgatacgatcctttctctctgtaaacattatatggttagtctcttaaaattcattcagagtctgctgaattcagcaactgccct |
3641708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University