View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6106_low_9 (Length: 251)
Name: NF6106_low_9
Description: NF6106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6106_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 31606992 - 31606901
Alignment:
| Q |
1 |
atgtgaattatgttatttggtggaaaattttgtctatcatttgaagttcttggaccaacctgccattcatcaacattaatcagaagtttaat |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31606992 |
atgtgaattatgttatttggtggaaaattttgtctatcatttgaagttcttggaccaacctgccattcatcaacattaatcagaagtttaat |
31606901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 31606867 - 31606813
Alignment:
| Q |
187 |
gcaaaattttacttgaatttgtaaagttttgaaataaaccataattttagtataa |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31606867 |
gcaaaattttacttgagcttgtaaagttttgaaataaaccataattttagtataa |
31606813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University