View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6108_low_7 (Length: 298)
Name: NF6108_low_7
Description: NF6108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6108_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 286
Target Start/End: Original strand, 5779036 - 5779307
Alignment:
| Q |
18 |
gaaagaatatttgcctcctgctgtccttcgcaaaattgccaatgatacgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatatagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5779036 |
gaaagaatatttgcctcctgctgtccttcgcaaaattgccaatgatatgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatatagg |
5779135 |
T |
|
| Q |
118 |
ataaacatcact---atgcttaacggctctgtggccgtcagcaacaacattgtccgagctctcgttactcggactttgtatgatcgctctccagttgctg |
214 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||| |
|
|
| T |
5779136 |
ataaacatcactgtgatggttaacggctctgtggccgtcagcaacaacattgtccgagctcttgttactcggactttgtatgatcgctctccaatcgctg |
5779235 |
T |
|
| Q |
215 |
tctacgctgtctccaaggtgttgatgccgaaagagcttcccgtgcccatcacctccgatgtcaccgccccta |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
5779236 |
tctacgctgtctccaaggtgttgatgccgaaagagcttcccgcgctcatcacctctgatgtcaccgccccta |
5779307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 21 - 252
Target Start/End: Original strand, 5817314 - 5817548
Alignment:
| Q |
21 |
agaatatttgcctcctgctgtccttcgcaaaattgccaatgatacgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggata |
120 |
Q |
| |
|
||||||||| |||| || ||| ||| | |||||| ||||| | ||||||||||| | ||||||| | |||||||||| |||| || ||||| |||| |
|
|
| T |
5817314 |
agaatatttttctcccgccgtctttccccaaattgtcaatgtttggcatttgcaagtcatggtggcagtcaaaatcatggggcaggataaatatatgata |
5817413 |
T |
|
| Q |
121 |
aacatcact---atgcttaacggctctgtggccgtcagcaacaacattgtccgagctctcgttactcggactttgtatgatcgctctccagttgctgtct |
217 |
Q |
| |
|
||||||||| ||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| |||| |||||||||||||||| |||| ||| | |
|
|
| T |
5817414 |
aacatcactgcaatggttaacggctctgtggccatcagcaacaacattgttcgagctctcgttacttggacattgtatgatcgctctctggttgttgttt |
5817513 |
T |
|
| Q |
218 |
acgctgtctccaaggtgttgatgccgaaagagctt |
252 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| |
|
|
| T |
5817514 |
acgccttctccaaggtgttgatgcccaaagagctt |
5817548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University