View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6109_high_10 (Length: 232)
Name: NF6109_high_10
Description: NF6109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6109_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 9692175 - 9691962
Alignment:
| Q |
1 |
atgtaattaatttaagtgtannnnnnngtacatgcagctatgtannnnnnncctaccttcaaaaggagtcattcctcttcataaccacccaggaatgact |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692175 |
atgtaattaatttaagtgtatttttttgtacatgcagctatgtatttttttcctaccttcaaaaggagtcattcctcttcataaccacccaggaatgact |
9692076 |
T |
 |
| Q |
101 |
gttttcagtaagcttttgttgggacaaatgcacattaagtcttatgattgggttgatcctgatgtctctcacaatttgttgaagcaaccatctcaatgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692075 |
gttttcagtaagcttttgttgggacaaatgcacattaagtcttatgattgggttgatcctgatgtctctcacaatttgttgaagcaaccatctcaatgta |
9691976 |
T |
 |
| Q |
201 |
tgtattcaaatatt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9691975 |
tgtattcaaatatt |
9691962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 64 - 181
Target Start/End: Original strand, 33528418 - 33528535
Alignment:
| Q |
64 |
aggagtcattcctcttcataaccacccaggaatgactgttttcagtaagcttttgttgggacaaatgcacattaagtcttatgattgggttgatcctgat |
163 |
Q |
| |
|
|||||||||||| || |||||||||||||| |||||||||||||| || ||| | || || |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33528418 |
aggagtcattcccctccataaccacccaggcatgactgttttcagcaaacttctattagggcaaatgcacattaagtcttatgattgggttgatcatgag |
33528517 |
T |
 |
| Q |
164 |
gtctctcacaatttgttg |
181 |
Q |
| |
|
| ||||||||| |||||| |
|
|
| T |
33528518 |
gcctctcacaacttgttg |
33528535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 152
Target Start/End: Original strand, 2201621 - 2201709
Alignment:
| Q |
64 |
aggagtcattcctcttcataaccacccaggaatgactgttttcagtaagcttttgttgggacaaatgcacattaagtcttatgattggg |
152 |
Q |
| |
|
|||||| ||||||||||| || ||||| |||||||| ||||| || |||||| | || ||| |||||||| || ||||||||||||| |
|
|
| T |
2201621 |
aggagttattcctcttcacaatcaccctggaatgacggtttttagcaagcttctatttggaactatgcacatcaaatcttatgattggg |
2201709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University